Q: Referring to the Fletcher-Munson curves shown, at approximately what frequency is the human ear most…
A: The Fletcher-Munson curves were discovered experimentally by Harvey Fletcher and Wilden A. Munson…
Q: Describe how hroughout the Games, performance-enhancing drug testing became more rigorous and…
A: Performance enhancing drug test in sports competition has became a common practice. Athletes use…
Q: Please explain mitochondrial DNA inheritance . How is it inherited ? Why is it predisposed to…
A: The cell contains the nucleus, which includes the cell's genetic material called nucleic acid. The…
Q: a) What dilution is created when you dilute 1mL of bacteria into 99mL of water? 10 What is the…
A: The stock solution is the more concentrated solution, while when one adds the solvent to it, then it…
Q: Fertilizer 33-0-0 0-46-0 0-0-60 Total material needed Fertilizer Needed lbs/acre 1 2 3 4 S/ton 980…
A: We need to apply N at a rate of 210 lbs/acre, phosphorous at 85 lbs/acre and potassium at 150…
Q: What are the usual physiologic changes of aging, and how are these differentiated from disease?
A: Aging is a progressive degeneration of the tissues of an organism which leads to a loss in the…
Q: Why is it critical that we learn how to sustain and preserve our coral reefs?
A: An underwater environment known as a coral reef is characterised by corals that construct reefs.…
Q: Describe how these ungulates (hoofed mammals) might affect ONE of the following the bird's habitat
A: Ungulates are thw hooked animals that live in the open forests and the grasslands. They are one of…
Q: ● ● . · Which of the following is considered an innate immunity: Production of antibodies via B…
A: Introduction: Innate immunity or nonspecific, immunity is the defense system which is present…
Q: How might overexpression of proto-oncogenes lead to abnormal cellular proliferation?
A: There are many ways in which overexpression of proto-oncogenes can lead to abnormal cellular…
Q: Describe the general immune response against a viral pathogen? Describe thoroughly the innate and…
A: immune responses are triggered by antigens. Antigens are found on the surface of pathogens…
Q: Insects constitute the largest animal group on earth. About 25-30% of the insect species are known…
A: Animals are of three different types: Herbivores, carnivores, and omnivores. Herbivores are animals…
Q: During the summer and fall of 2002, the West Nile Virus advanced north into Canada. This Virus…
A: West Nile Virus or WNV is a virus that causes West Nile Fever. It is an RNA virus whose genome is…
Q: The expected mean concentration (in mg.g-1 dw) of the offspring of these breeders is??
A: In selective breeding, narrow sense heritability can be estimated using breeders equation- R= (h2)S…
Q: What is the role of MHC class I and II proteins in cell-mediated immunity?
A: Introduction Immunity is the property or ability of the body to defend against pathogens. The…
Q: 9. Some invertebrates have a soft body that utilize their bodily fluids as an attachment point for…
A:
Q: 20-21. If the litter resulting from the mationg of 2 short-tailed cats contains 3 kittens without…
A: 20-21. If the litter resulting from the mationg of 2 short-tailed cats contains 3 kittens without…
Q: Answer the following questions. How many types of tourniquets are there? Which is appropriate for…
A: Disclaimer: - According to Bartleby guidelines, only the 1st question can be answered. Please repost…
Q: propose a brief experiment to identify members capable of assimilating methane- derived compounds…
A: Answer :- Microorganisms are too little to even consider seeing with unaided eye. We want magnifying…
Q: discuss the limitations in using the light microscope to study microbial communities.
A: Microscope is the most basic and useful instrument used in the microbiology laboratory. It is…
Q: Select all statements that correctly describe hemoglobin and myoglobin structure. By itself, heme is…
A: Introduction Myoglobin stores oxygen, whereas haemoglobin transports it. Red blood cells found in…
Q: Quadrupedal Anatomy (Cat) 1. What is the axis shared by (1) transverse and sagittal plane (2)…
A: The cat is one of the domestic species of small carnivorous mammal. It is the only domesticated…
Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences…
A: Introduction Transcription is a process by which mRNA is produce from DNA. Once the mRNA is formed…
Q: A botanist two diferen took trans Specimens s microscope Leat from Plant 1 с CC . P The plants а…
A: Stomata are the cell structures which are pore like found in the epidermis of leaves, stems etc.They…
Q: What are the key physical and chemical parameters that must be controlled in a fermenter?
A: Fermentation is the process of incomplete oxidation of substrates in absence of oxygen or under the…
Q: Classify the following viruses according to Baltimore classification by completing table. Virus:…
A: Introduction Smallpox is a caused by the variola virus. It is highly contagious and serious…
Q: Biology The food web of the harp seal is most dependent on which of the following organisms?. 1.…
A: Food-web is defined as "the network of complex interactions among species in an ecosystem"
Q: Owen below Dome Statement about fish post Poisoning in which Statement Encerning dcomborid fish…
A: Answer :- The option 3 is incorrect because symptoms are usually occurs within 1-24 hours. Scombroid…
Q: c. Questions 1. Which wavelengths of light are best absorbed by the chlorophyll extract? 2. Which…
A: Since there are multiple questions in this particular question, I will answer the three subparts for…
Q: Choose the best combination of depyrogenation methods: 0.45 um filtration +0.22 µm filtration…
A: Introduction Pyrogens are the substance that causes pyrexia( a type of fever). The gram-negative…
Q: You are dispatched to a 35 year old patient complaining of feeling anxious. Based on the above…
A: Anxiety is the most common situation that occurs in the today's stressful situation. The anxiety is…
Q: can help me help to understand this slides by labelling them and describe them
A: Areolar connective tissue is the kind of tissue that covers and links the body's many organs. The…
Q: d) Since we know this bacterial organism thrives in colder areas of the world, what can be said…
A: Bacteria are present everywhere in the world, including cold environments. Certain types of bacteria…
Q: Discuss the following statement in detail : " Conservation biology is everyone's business "
A: The key to convincing businesses and the general public that conservation is essential to their…
Q: How applications of CRISPR-Cas technology is used ?
A: A group of DNA sequences known as CRISPR can be discovered in the genomic of prokaryotic organisms…
Q: A signal transduction pathway leads to the regulation of one or more cellular activities. What does…
A: Signal transduction includes the binding of ligand to a receptor.
Q: sweet peas, the given enzymatic pathway result to pigment formation in the flowers:…
A: The example shown here is the example of epistasis where one gene is masked that is suppressed by…
Q: D a Which of the following is considered an innate immunity: ● Production of antibodies via B…
A: Immunity is defined as a complex biological system with the ability to recognise and tolerate what…
Q: Type of infection for the following and small info about them: E. Balantidiasis F. Sleeping…
A: Introduction An infectious disease brought on by parasites is referred to as a parasitic disease,…
Q: How do environmental factors such as climate, poverty, global travel, and bioterrorism influence the…
A: Environmental factors influence the rate, probability and susceptibility to transmission of…
Q: Adherence or Non - adherence to Asthma Controller Therapy? ASAP Summaries all this into bullet…
A: Asthma is one of the major diseases that are non-communicable that can affect both adults and…
Q: How do noncellular immune system components, including antibodies, complement, and clotting factors,…
A: The immune system is made up of mainly immune cells. There are different types of cells that play an…
Q: When a white cat was crossed with a black cat and all off springs were brown in color. How do you…
A: Two copies of each hereditary component segregate during gamete creation, according to Mendel's…
Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences…
A: Given DNA strand: 5' - CCTATGCAGTGGCCATATTCCAAAGCATAGC - 3'
Q: 5. Very happy Escherichia coli cells reproduce on a 20 minute time frame (doubling or generation…
A: Bacteria are ubiquitous microscopic prokaryotic organisms which exhibit 4 different stages of growth…
Q: Although many cloning applications involve introducing recombinantDNA into bacterial host cells,…
A: Recombinant DNA technology, often known as genetic manipulation or gene slicing, entails assembling…
Q: These are examples of environmental factors that influence indoor fungal contamination: Outdoor…
A: Answer :- The indoor environment essentially affects general wellbeing. Sensitivities, disease, and…
Q: Which four kinds of tissues arranged in various proportions and patterns?
A: One of the main structural groups in all animals is tissue. The cells that make up tissue are…
Q: 1. The following are the offspring produced by the cross of AaBBCc X AaBbCC, except: a.AabbCc…
A: In order to study the inheritance of three pairs of factors or alleles from three different genes,…
Q: 1. This picture below shows the external structures of the stem, how old do you think is this twig?…
A: Introduction A twig is a very tiny, delicate branch that emerges from a tree or bush's main branch.
Step by step
Solved in 2 steps
- 1. Create an inversion on your mini gene .. ? that results in an inversion. Sequence 5 ATGGTGCAAGATTAA 3' 3 TACCACGTTCTAATT 5' The sequence after the inversion is: 5 ATGCTTACGGATTAA 3 3 TACGAATGCCTAATT 5' Comments and help • By convention we write DNA sequences starting with the 5' end and ending at the 3' end. 4. Create mutation on the sequence on your minigene that results in an in-frame non-tandem duplication. • Also, by convention when you write double stranded sequences, the top strand is the 5' to 3' and the bottom strand 3' to 5'. 2. Generate a primer pair that is 6 base-pairs long to amplify the inversion you created, that will not amplify your wildtype mini gene. • If you are typing your answer, use the Courier font for the sequence. This allows proper alignment of the two strands. 3. Create point mutations on the sequence on your > minigene that results in: i. a frameshift, ii. a silent mutation, iii. a conservative mutation, iv. a missense, v. a nonsense mutation.5. Currently you are studying threonine synthesis in E. coli. To find genes whose protein products are important for threonine synthesis, you perform a mutagenesis to find mutants that require a source of threonine to grow. mtl mt2 mt3 nt4 mt5 mt6 mt7 mt8 mt9 wt You find a total of nine mutants, all of which have recessive phenotypes. You perform complementation tests with all of your mutants. Below are the results for your complementation tests. A (+) means growth and a (- means no growth: mtl mt2 mt3 mt4 mt5 mt6 mt7 mt8 mt9 Wt a. How many complementation groups did you identify? For each complementation group, indicate which mutants belong to that complementation group. ++ I++++ + + + + 主+4. The bars in the following sequence indicate the breakpoints of a deletion. 5'-CGGGTATCTACTAAA|TTCGCACTTACGAGGATTAACATCCGATTG|TACCGAATGAGAATC-3' Which primer pair would you use to genotype for this deletion, such that all genotypes will result in a band? a. 5'-CGGGTATCTACTAAA-3' and 5'-TACCGAATGAGAATC-3' b. 5'-CGGGTATCTACTAAA-3' and 5'-GATTCTCATTCGGTA-3' с. 5'-CGGGTAТСТАСТААА-З" and 5'-CCТCGTAAGTGCGAA-3' d. 5'-CGGGTATCTACTAAA-3' and 5'-CATCCGATTGTACCG-3' e. There is no way to design a pair of primers that provide positive evidence
- 5. The nucleotide sequences of the DNA molecules in the figure below were obtained from four different individuals, one wild type and three mutants. Wild Type 5'-TTATCCATGATCGGATCGATCCATTAGCCGA-3' 3'-AATAGGTACTAGCCTAGCTAGGTAATCGGCT-5’ Mutant I 5'-ATCCATGATCGGATTGATCCATTAGCCGAAT-3’ 3'-TAGGTACTAGCCTAACTAGGTAATCGGCTTA-5’ Mutant II 5'-CCGTTATCCATGATCGGATAGATCCATTAGCC-3’ 3'-GGCAATAGGTACTAGCCTATCTAGGTAATCGG-5’ Mutant III 5'-CACCGTTATCCATGATCGGAACGATCCATTAGC-3’ 3'-CAGGCAATAGGTACTAGCCTTGCTAGGTAATCG-5’ a) Identify the open reading frames in each sequence of DNA and translate them into proteins. Write down the sequence of amino acids that will be obtained after translation: b) Which of the mutations above would be least likely to cause a change in the function of the protein? Why? c) Which of the mutations above would probably cause a major disruption in the function of the protein? Why?5. Design a 10-bp primer that could be used to amplify the following sequence of DNA: 5'-AGTCGATCCCTGATCGTACGCTACGGTAACGT-3'A 4. You are given three different substances that are known mutagens. Using a variety of techniques, you analyze the results of exposure to these substances. Your findings are shown in the table below. Using this data, link each of the three substances with one of the following molecular properties and explain your choice. B C I. Substance II. III. One mutagen that looks like cytosine but forms a covalent bond with guanine One mutagen that can bind with either adenine or guanine A molecule that can insert itself between two base pairs in a DNA strand Result of exposure Increases the number of mutants that produce mRNA with AGA codons instead of AAA codons Significantly fewer viable colonies Increase in mutants containing frameshift mutations
- 4. A recent estimate of the rate of base substitutions atSNP loci is about 1 × 10−8 per nucleotide pair pergamete.a. Based on this estimate, about how many de novomutations (that is, mutations not found in the genomes of your parents) are present in your own genome?b. Where and when did these de novo mutations inyour genome most likely occur?3. Primer Design You are analyzing the region of DNA shown below to determine how many AATG repeats are present. To do so, you must amplify the entire region of AATG repeats. Design primers of 16 bases each so they anneal outside the region of interest. More than one primer pair is possible, but just give one. 51-АСTСGCАCGAACAGGCACTTAGGAATGAATGAАTGAATGAATGAАTGAATGACCTGтстссттсССАСТтсстСС-3' 3'-TGACCСтGтсттстссстGААТССТТАСТТАсТТАСТТАСТТАСТТАСТТАСТGGACACACCAAGGстСAAGGAGG-5' a. Primer 1: Primer 2:1. Methods of gene therapy 2. Explain Small RNAs and long non coding RNA. 3.what is name of the technique that would help a person who inherited LFS to have a child without the defective allele? 4 .Describe the main technique for amplifying a segment of DNA (like the one you suspect is involved in Lee’s cancer) from a complex mixture of genomic DNA. Remember that the entire human genome sequence is known. (Hint: This is a technique that is commonly used by laboratories that do genetic testing and various other applications of molecular biology.) 5. If Dr. Aikenhed wanted to see if there was mutation within the protein-coding sequence of the gene implicated in this disorder (as opposed to mutations afecting regulatory elements), what technique involving dideoxynucleotides could be used? Briefy describe this technique.
- 28. What type of mutation is seen here? WT: 5′-AUG GCU AGA GUU GAA AAA-3′ Mutant: 5′-AUG GGU AGA GUU GAA AAA-3′ Group of answer choices 1. Tranversion 2. Deletion 3. Transition 4. Insertion5. You are attempting to genotype a series of cells at gene A through restriction enzyme digestion. You know that the wild type allele "A" has 2 restriction enzyme cutting sites, creating bands that are 100bp, 200bp, and 300bp. A mutation creating allele "a" removes one of these cutting sites, creating bands that are 100bp and 500bp. How many separate bands would you expect to see on a gel for a cell that is heterozygous Aa?1. You are studying a variant in a gene controlling wing development, Wng, in Drosophila. Using analysis software, you can see that the variant changes the protein product’s amino acid sequence, but homozygotes for this variant express a WNG protein that functions normally. Which term best describes the effect of this variant? conditional mutation gain of function mutation loss of function mutation neutral mutation synonymous mutation 2. In base excision repair, Photolyase breaks bonds between pyrimidines & Purines Single-stranded binding proteins are used to stabilize the unwound helix. Mut H recognizes the demythylated state, and removes the base DNA Glycolase removes the damaged nitrogenous base 3. Aneuploidy is a change in the number of individual chromosomes. Which of the following is not an example of aneuploidy? Nullisomy Trisomy Monosomy Polysomy Tetrasomy