Answered: 2. How can you help preserve the rich…

2. How can you help preserve the rich species diversity of the Philippines? 3. Why is it important to prevent biodiversity loss in an ecosystem?

Human Biology (MindTap Course List)

11th Edition

ISBN:9781305112100

Author:Cecie Starr, Beverly McMillan

Publisher:Cecie Starr, Beverly McMillan

Chapter25: Human Impacts On The Biosphere

Section: Chapter Questions

Problem 2CT

See similar textbooks

Related questions

Q: A team of investigators is out on a boat on a lake on a marvelous,sunny summer day, and they are…

A: Introduction Ocean have totally different ecosystem as there are different factors that affect the…

Q: Compare the structures and functions of the receptor molecules for salty and sour taste; the…

A: In our body, taste receptors are that kind of receptors who can senses the taste of food in oir…

Q: One of the most widely used means of communication among insects is chemical communication. How do…

A: Pheromones is a chemical released by an animal which ultimately changes the behaviour of a another…

Q: Discuss the role of par genes in generating anterior/posterior polarity in the C. elegans embryo.

A: C. elegant is a nematode that is used as a model organism in developmental research. Six proteins…

Q: Ultraviolet radiation can cause purine and pyrimidine bases to cross-link. True false

A: Adenine and thymine are the purines which are smaller two-ringed bases, and the pyrimidines consists…

Q: 5. Describe a density-independent factor and explain why its effect on population growth is…

A: Food or nutrient shortages, environmental pollutants, and climate extremes, such as monsoons, are…

Q: Which strand below would be the complementary strand for the sequence AAACGCTT O GGGTATCC O AAGCGTTT…

A: A "nucleic acid" is a linear polymer of nucleotides that is a component of the cell's information…

Q: In sexual differentiation, parts of the male reproductive system develop from the:

A: The formation of different proteins that lead to formation of different cells and thereby tissues…

Q: What kind of evidence would indicate that the ability to taste PTC is inherited? Why was it…

A: 1. The ability to taste PTC shows a dominant pattern of inheritance. A single copy of a tasting…

Q: Discuss the significance of the Hardy–Weinberg principle as it relates to evolution and list the…

A: In the absence of disrupting events, the Hardy-Weinberg equilibrium implies that genetic changes in…

Q: 9) Choose the best answer. Identify the two types of anaerobic respiration.

A: Anaerobic respiration is defined as a biochemical process of respiration not involving oxygen.'…

Q: In an investigation of fruit fly behavior, an enclosed choice chamber was used to test whether the…

A: A spatial distribution is a graphical representation of a phenomenon's distribution throughout the…

Q: 23. Which form of carbon is found in hard sponges, corals, and clams, but not in Earth's atmosphere?…

A: Calcium carbonate, or CaCO3, constitutes more than 4% of the earth's crust and may be found all over…

Q: 7. Complete the following diagram which describes a small eukaryotic open reading frame, by filling…

A: Genes are the fundamental unit of heredity. They store genetic information in the form of DNA, which…

Q: Which of the following statements is unique to skeletal muscle? O a) skeletal muscle has striations…

A: Muscular tissue is the specialized tissue in animals which applies force by contraction for the…

Q: According to the __________ perspective, physicians rose to dominance in the American health care…

A: Healthcare industries has taken a great initiative in many perspectives. Moreover with the…

Q: 28. According to the central dogma of genetic information transfer (proposed by James Watson and…

A: Central dogma proposed by James Watson and Francis crick states the genetic information transfer in…

Q: What are the possible genotypes of the offspring if you cross a brown cow and a black cow? Black cow…

A: Here C is the dominant allele for black color and c is the recessive allele for white colour.…

Q: Outline the events in the innate and adaptive immune responses, from when a pathogen invades to…

A: Introduction Immunity: it is the property/capability of our system to fight against the harmful…

Q: Choose the correct answer: A) When the voltage gated K+ channels open K+ moves down its…

A: Let us discuss each option separately to figure out the correct option out of all. Whenever voltage…

Q: One type of epithelial tissue can convert into another under certain abnormal conditions. Give two…

A: Introduction :- The epithelium is a type of body tissue that forms the covering on all of your…

Q: schema __ illustrates simple segragation. shema__illustrates how interpersion is violated during…

A: * Different designs of tank arrays modified and redrawn from ocean acidification . * Different…

Q: Discuss the process of eukaryotic transcription in details please.

A: Transcription is a process in which RNA is synthesized from the template strand of DNA. Like any…

Q: Explain sexual reproduction in bacteria?

A: Despite the fact that bacteria do not have true sexual reproduction, they exhibit genetic…

Q: Can the frequencies of all genotypes in a population be determined directly with respect to a locus…

A: The dominant allele causes a dominant phenotype in an individual and is composed of one copy of any…

Q: In Mendel's genetic experiments many characteristics of the plants were quantified, such as their…

A: Mendel uncovered the fundamental laws of heredity. His experiments demonstrated that the inheritance…

Q: Which group of animals have endoskeletons? Annelids and Mollusca Cnidaria and Ctenophora O Nematoda…

A: Endoskeleton is internal bone or cartilage structure of animals which have a vertebra and some…

Q: How can the heart be strong enough to pump blood up your legs against gravity?

A: The heart is incapable of pumping blood back up the veins in your legs and back to your heart on its…

Q: One example of the DENR requirements on environmental safety guidelines when work is located on…

A: DENR The department of environment and natural resources take care of natural resources of country…

Q: describe the process of lysosomal hydrolase arriving to the lysosome. without including translation

A: The targetting of lysosomal enzyme depends on GERL system. Lysosome, Golgi bodies, endoplasmic…

Q: 1. Embryonic stem cells continuously divide and remain undifferentiated. In order to maintain this…

A: Answer 1:- There are the following genes which are required to exhibit pluripotency:- Pou5f1 Oct4…

Q: explain about the genetic drift -differentiate founder effect from bottleneck effect.

A: Evolution is a steady phenomenon which bring about transformation of life from much simple one to…

Q: Define microevolution.

A: Introduction:- Evolution is the process of a species' features changing over numerous generations…

Q: Explain the sequencing-by synthesis (SBS) approach ?

A: One of the well-known states that are known as fundamental topics in Arithmetic is sequence and…

Q: What is the final electron acceptor for aerobic organisms? What does this mean?

A: Aerobic respiration needs oxygen. It is the release of large amount of energy in cells by breakdown…

Q: Ku proteins involve. nucleotide excision repair DNA repair before S phase single DNA strand break…

A: The Ku proteins bind to the ends of the linear phage DNA and stimulate LigD to ligate the ends to…

Q: Temperature-dependent sex determination (TSD) is the method of sex determination in sea turtles. In…

A: The answer to this question is solved in serial wise. A) Cellular Events

Q: Question:- In terms of nerve action, describe 4 different molecular components involved. And for…

A: Movement of action potential along a nerve fiber in response to a stimuli is known as nerve action…

Q: What important biological characteristics of life depend on mitotic cell division?

A: Cell division is a process that results in the development of two daughter cells is named Mitosis.…

Q: One of the most widely used means of communication among insects is chemical communication. How do…

A: *pheromones are chemicals released by an organism to external environment which takes specific…

Q: Given the DNA strand with sequence 5' AUGGAGGAUGGCCAGUCAAUUUGA 3' match the various mutations to the…

A: Codon is a sequence of three nucleotides that corresponds to a specific amino acid. Codons encode…

Q: er? TEalUNET ENED Hh Short Height: 25% 8. In flies, long wings (W) are dominant to short wings (w).…

Q: When is a tetrad specifically formed? Would it be found in a haploid or diploid cell? What event…

A: The "cell cycle", also known as "cell division", is a set of processes that occur in a cell leading…

Q: What is the role of glial cells in the brain and other parts of the nervous system?

A: Introduction :- Glial cells, also known as neuroglia, are cells that surround and support the…

Q: Explain why monarchs have different survival probabilities in species A and B

A: The monarch butterfly and natural milkweed plants have a symbiotic relationship. Monarch butterflies…

Q: Metabolism Basics Energy Relationship Type of Reaction Builds Larger Example Amino acids join to…

A: As per our company guidelines we are supposed to answer only first question. kindly repost another…

Q: Why is mutation important to evolution if it is the microevolutionary force that generally has the…

A: Microevolution is the evolution that acts on a small population or in a single species and it is…

Q: Gene and regulation of gene activity.

A: Gene regulation means how a cell regulate which genes are expressed among many other genes and…

Q: 2. In the guinea pig, a locus controlling coat color may be occupied by any of 4 alleles with the…

A: To Determine the genotypic and the phenotypic ratios of the offspring if the guinea pigs have coat…

Q: What is the rationale for synthesizing and rapidly degrading p53 protein in the cell?

A: P53 is a nuclear transcription factor with pro apoptotic function as 50% of human Kansas carries…

Concept explainers

Conservation Biology

The study of how to prevent the loss of biological diversity on the planet is called conservation. Biological diversity, also termed biodiversity, consists of various life forms found in a specific location or across the entire planet, including ecosystems, species, populations, and genes. Conservation thus aims to protect the diversity of life at all levels of biological organization.

Question

w7 analyze. answer 1 2 3 4 and 5

1. You want to know the ecosystem diversity of the Philippines. How will you do so? What examples
of ecosystems are found in the country?
2. How can you help preserve the rich species diversity of the Philippines?
3. Why is it important to prevent biodiversity loss in an ecosystem?
4. Why is it important to measure the level of biodiversity present in a community?
5. How can the changes in biodiversity affect humans?

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Answer the following: 1. How does biodiversity provide for people’s medical needs? 2. How do researches that utilize biodiversity affect the community? 3. Why are the cultural tradition of the community important in consuming or using the goods sourced from biodiversity? 4. How do business and development affect biodiversity?
Protecting biodiversity 1. What characteristics make a species MORE susceptible to extinction/endangerment? (And conversely,what characteristics of a species would make it LESS susceptible?) 2. How were hunting & fishing laws an important “first step” in conserving biodiversity? 3. How is the endangered species act different from a fish/game law? 4. What important “addition” to our interpretation of what the ESA prohibits was established in 1995?
How would you our reconcile the emerging needs of human beings regarding their health and the need to protect the growth of biodiversity? Do you think that earth can exist without human beings taking care of it? Or biodivesity also needs human beings for it to be in continous growing process? What are small ways that you think would promote safekeeping our biodiversity? What do you think are the common human activities that can harm biodiversity? What would be the consequences if these human activities might be stopped and prohibited?
1. What is biodiversity? Include a description of the different scales at which biodiversity can be measured. 2. Why is protecting biodiversity important? 3. What are the major threats to biodiversity? 4. Identify and describe three sources of habitat loss.
Answer the following: 1. What is your take on the value of biodiversity for health and medicine? What are the parameters to distinguish the good and bad ways of utilizing biodiversity in this context? 2. How do business and development affect biodiversity? 3. Why are the cultural tradition of the community important in consuming or using the goods sourced from biodiversity?
1. Why is biodiversity important particularly here in the Philippines?2. What makes the Philippines rich in biodiversity?
What kind of ecosystem are exotic species especially threatening to? a. deserts b. marine ecosystems c. islands d. tropical forests
Exotic species are especially threatening to what kind of ecosystem? deserts marine ecosystems islands tropical forests
What do you think are the common human activities that can harm biodiversity? Consider the small ways you can help to promote the conservation and preservation of biodiversity.
What are small ways that you think would promote safekeeping in our biodiversity? What do you think are the common human activities that can harm biodiversity? What would be the consequences if these humaj activities might be stopped and prohibited?
4) The figure below displays the three levels of biodiversity. Please label them and the answer the questions below. a) How are these related to one another? What would happen if one or more then one was throw off? b) What are ecosystem services and why are they important to humans? What is an example of an ecosystem service?
We often hear about the importance of conserving biodiversity, but the reasons aren’t always clear. Briefly explain 3 ecologically relevant reasons why biodiversity is important.