3 HaelII --- 5’ CC ↓ GG 3’ 5’ ACGCCGGCCGTATTAT CCGGATCCGCCG CCGGCTGTCCCGGATCA 3’ 3’ TGCGGCCGGCATAATAGGCCTAGGCGGCGGCCGACAGGGCCTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
Q: The recognition sequence for the restriction enzyme TaqI is T↓CGA. Indicate the products of the…
A: Restriction enzyme is a protein that recognizes a specific, short nucleotide sequence and cuts the…
Q: Restriction digestion and Gel electrophoresis: A single strand of a double-stranded DNA sequence is…
A: Restriction digestion is a process in which DNA is cut into smaller pieces at specific sites with…
Q: The beginning of the hexose kinase gene's sequence can be found below, the +1 nucleotide is…
A: Primer is short sequence which is complementary to the base sequence of DNA and is considered to be…
Q: Based on the restriction enzyme specificities given below, which will generate blunt ends?…
A: Restrictions enzyme or restrictions endonucleases is type of protein, produces bacteria that helps…
Q: For the chromatogram below, what is the sequence of the template DNA from base 115 to 125?…
A: According to the question, we have to answer the question that which is for the chromatograph below,…
Q: The beginning of the hexose kinase gene's sequence can be found below, the +1 nucleotide is…
A: The ds DNA strand between position 20-30 3'- GATACGCGATG- 5' The sequence of primer that will be…
Q: 1) You would like to clone a gene by PCR. The sequence of the two ends of the coding strand for the…
A: A laboratory technique for amplifying DNA sequences is polymerase chain reaction (PCR). The approach…
Q: 1. (a) What will be the newly synthesized DNA from the template given? DNA Template 3 -…
A: The base-pairing rule in DNA is that cytosine (C) pairs with guanine(G) and adenine (A) pairs with…
Q: What would the amino acid sequence be for the following DNA Transcript?…
A: DNA is the molecule that stores the information for the coding of the protein sequences in the human…
Q: Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
A: In the question a DNA sequence is given with its nucleotides. Restriction enzyme is an enzyme that…
Q: A researcher wants to cut this piece of linear DNA. 5 AGCTAGTCCGGATCCGAGGGCCCTTCTCATGAGATCCGGATGACC…
A: The discovery of restriction enzymes in 1968 by Swiss scientist "Werner Arber" ushered in the era of…
Q: #4 BamI --- 5’ CCTAG ↓G 3’ 5’ ACGCCTAGGACGTATTATCCTAGGTAT CCGCCGCCGT CATCA 3’ 3’…
A: A restriction enzyme is a type of enzyme which cleaves DNA into fragments at a specific recognition…
Q: Which of the restriction enzymes listed in the table below produces blunt-end fragments? Enzyme…
A: The blunt end are produced by the restriction enzymes when the end of a DNA fragment after breaking…
Q: The restriction enzyme Smal recognizes the following sequence and cuts it once between the G and C:…
A: Answer. A restriction endonuclease is a bacterial enzyme that cuts double-stranded DNA by cleaving…
Q: Below is a piece of DNA, and under that in BOLD is the RNA that was produced from that DNA.…
A: The central dogma of molecular biology given by Dr. Francis Crick states that the information stored…
Q: Table 2. DNA Sequence 2 from Lactose-Tolerant and -Intolerant Individual Individual Phenotype…
A: Introduction:- Chromosome usually represent the long chain DNA molecules that have the genetic…
Q: Restriction Enzyme Specificities: GAATTC... Hpal.GTTAAC... ..CTTAAG... PstI .CTGCAG... ..GẠCGTC...…
A: Restriction enzyme is protein found in bacteria which cleaves DNA at specific sites along the…
Q: A researcher wants to cut this piece of linear DNA. 5'…
A: The restriction enzymes are the specific enzymes that act on the DNA molecule and perform its…
Q: Give the correct DNA template for this bacterial gene segment (GGG UCG ACA CỤC UUU). ***"Please use…
A: Since you have posted a question with multiple sub- parts,we will solve the first three sub-parts…
Q: Based on the following wild type DNA sequence, indicate if each of the mutations should be…
A: DNA is a nucleic acid formed of two strands of nucleotides. The nucleotides have nitrogen bases that…
Q: Coding With the given coding strand perform the following 1. supply the correct non- coding strand…
A: DNA is a double helical molecule.
Q: Below is a portion of a bacterial chromosome that contains a gene. The promoter region and the +1…
A: Transcription is the process of making RNA copy of gene sequence. This copy is called mRNA.…
Q: You are studying a protein that contains the peptide sequence RDGSWKLVI. The part of the DNA…
A: The restriction endonuclease are responsible for cutting the DNA at specific sequence and they…
Q: Below is a portion of a bacterial chromosome that contains a gene. The promoter region and the +1…
A: Nucleic acid is a macromolecule that is exhibited inside the nucleus . It consists of DNA and RNA…
Q: 3. You want to insert a sequence in the lacl gene to alter its function, what restriction enzyme(s)…
A: Introduction: The lac operon is a polycistronic structural gene controlled by a promoter and a…
Q: Based on the restriction enzyme specificities given below, which will generate blunt ends?…
A: The given restriction enzymes are endonucleases as they cut nucleotides at specific positions within…
Q: You amplify the DNA sample shown with the indicated primers. Highlight in yellow the region that…
A:
Q: Answer the following 2 questions based on the given sequence of DNA. The top strand is the template…
A: The central dogma of DNA consists of transcription and translation. In transcription, the DNA makes…
Q: The chromatogram shows fluorescent peak data from a dye-terminating nucleotide-sequencing reaction.…
A: Sanger sequencing (also known as chain termination sequencing) is a DNA sequencing technology that…
Q: Another restriction enzyme is called HaellI. It cuts DNA at the following base sequence: CCGG GGCC…
A: restriction enzymes are those enzymes which helps in cutting dna at specific locations .
Q: HpaI --- 5' GTT - AAC 3' 5' GGATGTTAACAATCTCTACGGGTTAACACCCTTGGGTTAACATCCGCGG 3' 3'…
A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: Table 2. DNA Sequence 2 from Lactose-Tolerant and -Intolerant Individual Individual A IV-3 Phenotype…
A: Chromosomes are the rod shaped, dark stained bodies which are most prominently seen in the metaphase…
Q: The DNA sequence of one strand of a gene from threeindependently isolated mutants is given here (5′…
A: The mutant gene produces when there are changes in the sequence of nucleotides in the wild type…
Q: Please determine the relative location of the three restriction enzymes. Enzyme Number of fragments…
A: Restriction enzymes are a type of enzyme that can detect and cleave a certain short sequence of…
Q: Describe the process for shotgun sequencing of a genome. Practice aligning the two sets of sequenced…
A: Since you have posted multiple questions, we solve the first question for you. To get the remaining…
Q: The following is the base sequence of DNA that codes for amino acids 506-510 of the protein that…
A: Since we only answer up to 3 sub-parts, we’ll answer the first 3. Please resubmit the question and…
Q: Refer to Figure , which describes the base modifications of bacteriophage T4 DNA, and briefly…
A: As The main issue is relating to the modification of nucleotide - i.e. replacement of 5…
Q: Which of the following sequences in double-stranded DNA ismost likely to be recognized as a cutting…
A: Enzymes that can cleave the DNA at specific sites are known as restriction enzymes. There are two…
Q: Table 1 shows a list of restriction endonucleases with their recognition sequence and the sites of…
A: Restriction enzymes are those that cleave the double stranded DNA at specific site. They have…
Q: #2 EcoRI --- 5’ G ↓AATTC 3’ 5’ ACG ACGTATTAGAATTCTTA TCCGCCGCCGGAATTCT CATCA 3’ 3’ TGC…
A: Restriction enzymes is an enzyme that cleaves DNA into fragments. Recognition sequence is a unique…
Q: The recognition site of some restriction enzymes are shown. Which will produce sticky ends? A.…
A: Restriction enzymes also known as restriction endonucleases are the enzymes which acts on the…
Q: Gly Leu (F) (L) Glu Asp (D) Ser (S) Tyr Ala (A) GUC Cys (C) G U Val (M) U GNP (W). Arg (R) G A C Leu…
A: Any change in the genetic material, which is not caused by recombination, that leads to altered…
Q: How many statements are right? 1. operator is a protein (transcription factor) that interacts with a…
A: Operators are the sequence that is present on the DNA and controls the gene regulation. The…
Q: You want to amplify the DNA between the twostretches of sequence shown in Figure Q8–3. Of the…
A: In molecular biology, PCR is used to make multiple copies of (amplify) tiny regions of DNA or a…
Q: 8. You have a piece of DNA with the sequence shown below.…
A: EcoRI is one of the most commonly found restriction endonuclease and it is isolated from the E.…
Q: The restriction enzyme Haelll has the recognition sequence below and cuts between the G and bases.…
A: restriction enzymes are the specific endonucleases that have a specific site within the DNA sequence…
Q: What is the role of Mg2+ in this reaction?
A: The given reaction is the DNA synthesis by the DNA polymerase I. DNA polymerase catalyzes the…
Q: What size DNA fragment would be released after very mild digestion of chromatin with micrococcal…
A: Introduction Micrococcal nuclease in as example of endo-exonuclease which is obtained from…
#3 HaelII --- 5’ CC ↓ GG 3’
5’ ACGCCGGCCGTATTAT CCGGATCCGCCG CCGGCTGTCCCGGATCA 3’
3’ TGCGGCCGGCATAATAGGCCTAGGCGGCGGCCGACAGGGCCTAGT 5’
Restriction enzyme:
Recognition sequence:
Number of pieces of DNA:
Type of cut:
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- * Le TH Sa u GWG AA PE x GWB Bi 31 K S. .com/forms/d/e/1FAlpQLSeRQOhizlj9haFIAG8XZwqYqNjd4lzDAumrUT8-Azr5lcf77g/viewform?hr_ submission=Chkl14ORirMBEhA e A 33rd Period 10th Gr... Maps H Mail - SC458917 -.. A 33rd Period 10th Gr.. E Applied Educationa.. A To-do A researcher uses a logistic model of population growth. Which statement best describes the relationship between time and population size in a logistic growth model? Over time, population size increases without limit. Over time, population size increases and then levels off to a maximum value. Over time, population size decreases and then levels off to a minimum value. Population size is not related to the passage of time. As limiting factors, how do disease differ from a forest fires? thing 1O DELLposition position (5' end) position (3' end) UUU Phe - F UUC Phe UAU Tyr Y. UAC Tyr UAA Stop UGU Cys UGC Cys UGA Stop UGG Trp UCU Ser UCC Ser U UUA Leu UUG Leu UCA Ser UCG Ser UAG Stop W 輔 CAU His CGU Arg CGC Arg CGA Arg CGG Arg CUU Leu CCU Pro CUC Leu CCC Pro P. CCA Pro CÁC His CỦA Leu CAA Gln CUG Leu CCG Pro CAG GIn AUU lle ACU Thr AAU Asn AGU Ser AUC lle ACC Thr -T ACA Thr AAC Asn_ AGC Ser AGA Arg AGG Arg A AUA lle AAA Lys EK AAG Lys AUG Met ACG Thr GUU Val GGU Gly GGC Gly GGA Gly GGG Gly GAU Asp D GAC Asp GCU Ala GUC Val -V GUA Val GCC Ala GCA Ala GCG Ala G - A GAA Glu FE GAG Glu GUG Val Nonpolar Polar Basic Acidic Stop codon Table 4.1 Biology: How Life Works, Third Edition © 2019 W. H. Freeman and Company Consider the DNA sequence–3'-CACTGGTAGCGA–5', • What is the sequence of the messenger RNA sequence that is transcribed from this DNA sequence? (Indicate the 5' and 3' ends of the RNA molecule.) • Consult the genetic code that is shown above. What is the amino acid sequence of the…9 Biology: SC4) x 4 dgv-frqz-vjb x M Inbox (1,514) xB Unit 7: Geneti x O Flipgrid | dc6 x O Worked exam x 4 My Drive - Gc x B copy retake - x G how do you s x + A docs.google.com/document/d/10EqJmVt6VK9YT1NRySx9c2AawGp069S6R6g|28ljkk4/edit I Apps O UCSMP OmnID Portal • SS 9 Home | Schoology M Gmail 4 Google Drive ClassZone - jAvan... flextime.edinasch... N Netflix w Wish - Shopping. >> copy retake ☆ A Share File Edit View Insert Format Tools Add-ons Help Last edit was 2 minutes ago 100% - G E = = E = 1E E - E - E E Image options Replace image- O Editing 31 1 2 | II 3 | 4 5 | 6 7 General Biology Unit 7: Genet. Your "One Pager" must conta. Part 1: Complex Inheritance . + For the two problems, make s.. 2 + Part 2: Pedigree Analysis 2. So, the genotypes of the pare.. II Talking about phenotypes: 2 3 5 6 E I : Shaded individuals have a rare genetic disorder. THIS IS NOT 1. Is the disorder dominant or recessive? How do you know? (Which individuals on the pedigree did you use to make this…
- Mutated DNA Sequence #2 T A C G A C C T T G G C G A C G A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ________________________________Mutated DNA Sequence #3 T A C A C C T T A G C G A C G A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ________________________________ Mutated DNA Sequence #4 T A C A C C T T G G C G A C T A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ______________________________134 LABORATORY Size of the Cell U22T RAJUBAV RO OJA Shape of the Nucleus 916 91032 Degree of Chromatin Condensation Presence or Absence of Nucleoli Cytoplasmic Staining Blood Cells Presence of Cytoplasmic Granules Cytologic/Histologie 18: or cellule Bone Marrow Cells of the develo eveloping cells noil Identi 010
- b. Cleavage with chymotrypsin produces the following fragments: Band A: CN , NLQY, GIVEQCCHKRSEY Band B: F, Y, DPTKM, IACCVRGF, RTTGHLCGKDLVNALY Cleavage with Staphilococcus aureus V8 protease produces the following fragments: Band A: GIVE, YNLQNYCN, QCCHKRCSE Band B: PTKM, RTTGHLCGKD, LVNALYIACGVRGFFYD What is the amino acid sequence of the protein? Type your response1B 3/23 DNA/Protein Synt x S le festin song analysis | Scho0 X G what compounds are respons mmon-assessment-delivery/start/4797160920?action3Donresume&submissionld%3D468979669 English 9 Student D.. A Type of Genetics Cr. S TEWWG Chapter 1. ppppppppppppppp. ONA Protein Synthesis Test DNA REPLICATION DNA Replication takes place during v and the end result is 5 67 8 9 10 11 Support Schoology Blog I PRIVACY POLICYAa Po AaBbCcDc AaBbCcDdEe AaBbCcDdE AaBbCcDdE AaBbCcDdE BIUVab x, x A ev A 三==|這、|の Caption Emphasis Heading 1 Heading 3 Heading 4 Style Pane (a) Complete the table, using a letter D, R or B, to show whether each statement applies to: Fo DNA only (D) TA2G – Completed forms must be available for Open Awards external moderation purposes. Page 6 of 15 > T | RNA only (R) Both DNA and RNA (B) Statement D or R or B Contains thymine Contains ribose Consists of two chains connected to each other with hydrogen bonds Has a sugar-phosphate backbone Has four different nitrogenous bases Contains a pentose sugar Is found in the nucleus and cytoplasm English (United Kingdom) Focus 目民 2490 words +1
- Word AaBbCcI AaBb CcD AaB AaBbCсI AaBbCcL 4 1 Normal Subtitle Title 1 No Spaci... Subtle Em..... Create and Share Adobe PDF Styles Adobe Acro P 1 1 2 4 A 3. A AL T L 4 E 5 E Question 6: The largest chromosome in Mischievous gremlinus has a length of 9 x 107 base pairs. The rate of DNA synthesis is 3,000 bp per minute at each replication fork. a. How long does it take to replicate the entire chromosome from a single origin of replication located exactly in the middle of the chromosome? Assume no pauses. I b. Experiments performed by Professor Trink reveal that it takes only 20 minutes for a growing cell to replicate this chromosome. What is the minimum number of replicons present on the chromosome? Florian Fischer Find v Replace Select Editing 153 23Complete the sentences about unusual DNA structures. is a DNA repeat that does not have a complementary sequence in the same strand. some secondary structures. Any sequence, such as a palindrome, that can be rotated 180° horizontally and 180° vertically such that it superimposes a sequence repeat on another sequence is In refers to self-complementarity within a strand. This sequence may contribute to the formation of A four-stranded, right-handed helix formed by a DNA segment containing a high proportion of guanine residues is known as The sequence An example of an inverted repeat that occurs within a single DNA strand is -GTGAG... .CTCAC- -CACTC. .GAGTG- interstrand hydrogen bonds break and intrastrand hydrogen bonds form. .. is which has the potential to form can form when a polynucleotide strand forms major groove of a homopurine-homopyrimidine duplex that contains a mirror repeat. A single DNA strand with the sequence - ATATG with functional groups in the CATAT- can form a…GAG Glu GGG Use the genetic decoder provided to assist in answering this question.\ Second letter UGUT UGC Cys Stop UUU UTo UCU UAU Tyr ULIC Phe UACJ Ser UCC UAA Stop UGA A UAG Stop UGG Trp G UUA nan onn UCG OLeu UCA CAU CGU) CACHS Pro CAA CUU CCU His C CUC Leu C CUA LEUCCA ) Gin CAGJ CGA Arg CUG CGG ACU AAULAso AGUser AUU AUC le AUA AUG Met ACG ACC ACA The AAA AGA AAGJ AGG JArg 6 FLys GAUAn GU GUU GUC GCU GCC Asp Val GUA GAC Ala GAA Glu GAG GGC A Gly GGA GGG GCAA GUG GCG What do you predict would happen if you created a tRNA with an anticodon of 5'-AGG-3' that is charged with methionine, and added this modified tRNA to a cell-free translation system that has all the normal components required for translating RNAS? We did one like this in class... we have to think'about the directionality (5' -> 3' or 3' -> 5'). The easiest way is to draw out your anticodon and codon first, and then consider are the strands going to line up parallel or anti-parallel. O a. methionine would be…