7. Match the anticodons with the corresponding codons. Consider the laws of super wobble. Codon (5' to 3 anticodon (5' to 3') a. AAU i. GUU b. AAC ii. GGA C. UCU iii. UGC d. UCC iv. AUU e. GCG v. AGA f. GCA vi. CGC I
Q: Marasmus is associated with ____. a. changes in skin and hair pigmentation b.…
A: The question is asking to identify the symptom that is associated with Marasmus, a severe form of…
Q: Select the two most accurate statements that describe the relationships shown on the graph. 72% +…
A: 1992 and 2013, there was a simultaneous increase in carbon dioxide levels and a decrease in oxygen…
Q: According to chemist John Dalton, if one mole of nitrogen is combined with three moles of hydrogen…
A: The objective of the question is to calculate the molecular mass of ammonia (NH3), which is formed…
Q: Pierre Simon de Laplace claimed that all of the following planets in our solar system are older than…
A: Pierre-Simon Laplace, was a renowned French mathematician as well as astronomer He made important…
Q: According to Stephen Hales, if systolic blood pressure in the brachial artery (SBP) = 150 mm Hg, and…
A: The objective of the question is to calculate the mean arterial pressure (MAP) given the systolic…
Q: Clara was solving the equation 4n+2−3(2−n)=31 the work for which is shown below.
A: Clara is solving an equation, which means she's trying to find the value of "n" that makes both…
Q: Make a pathophysiology of Upper respiratory tract infection
A: The objective of this question is to understand the pathophysiology of an Upper Respiratory Tract…
Q: What is/are the possible genotype(s) of an individual who is lactose intolerant?
A: The objective of this question is to identify the possible genotypes of an individual who is lactose…
Q: Nothartcus is an extinct early primate that lived around 50 million years ago. With long curved…
A: The question is asking whether Notharctus, an extinct early primate, had hands similar to ours, with…
Q: 6. To be considered national origin harassment, which of the following statements is correct? The…
A: The harassment victim's native language must not be English. - This statement is incorrect. National…
Q: Hydrolysis of a polysaccharide is accompanied by order. AG and negative increased zero unpredicted…
A: This is because the hydrolysis of polysaccharides, like the breakdown of starch or cellulose into…
Q: 3. Which of the following best describes retaliation for a claim of harassment? An action taken…
A: An action taken by a harassment victim against the harasser - This option is incorrect because…
Q: Please answer question number 3 and 7 now it Anthro work
A: Approach to solving the question: Detailed explanation:Question 2 OsteoarthritisQuestion 3:To…
Q: The KM of a Michaelis-Menten enzyme for a substrate is 1.0 x 104 M. At a substrate concentration of…
A: To solve this problem, we will be using the Michaelis-Menten equation: V=Km+[S]Vmax[S]Now let's…
Q: 2. Which should be considered when a person becomes incontinent? Decrease in caffeine intake…
A: Note: Hello, student. I sincerely hope I was able to answer your question. If you have any more…
Q: 8. True or False: The goal of using the hand under hand technique is to perform the task for the…
A: Note: Hello, student. I sincerely hope I was able to answer your question. If you have any more…
Q: I need help with this question
A: Approach to solving the question: Detailed explanation: Examples: Key references:
Q: GQ1
A:
Q: Joseph Black (Royal Society of Edinburgh) found that heating magnesium carbonate produces:…
A: The objective of the question is to identify the product formed when magnesium carbonate is heated,…
Q: make sure it’s correct
A: The sex of turtles is dependent on or determined by the temperature in such a way that warm eggs…
Q: eve stripe 2 reporter A B Hunchback C D 6999 Kruppel E F D In the early Drosophila embryo, the…
A: Option b: No reporter gene expression. This option is correct or incorrect because the krupple…
Q: I need help woth this question please
A: As answered above.
Q: please help
A: The name of the compound is 1,4-Cyclohexanediol1,4-Cyclohexanediol is a chemical compound with the…
Q: Be sure to answer all parts. Calculate the equilibrium constants for decomposition of the following…
A: To calculate the equilibrium constants (K) for the decomposition of hydrogen halides into hydrogen…
Q: make sure it’s correct i need asap
A: When drought forces elephants to migrate, it's like a big move for them. Suddenly, they find…
Q: Below is an EMSA showing four different reactions, A-D. In each tube there is some combination of…
A: Reaction A: Protein X only. No DNA probe or antibody present. This is inferred because there is no…
Q: How do these molecule function: Nucleic Acid, DNA,Messenger RNA (mRNA), Transfer RNA (tRNA),…
A: The question is asking about the functions of various biological molecules, specifically nucleic…
Q: None
A: Approach to solving the question: Detailed explanation: Examples: Key references:
Q: Homo floresiensis describe the fossil/ DNA etc. and where it comes from. Describe what makes this…
A: Homo floresiensis, often referred to as the 'Hobbit', is a species of small archaic human that…
Q: Match the following terms with the best description. Question 6 options: A…
A: The objective of the question is to match the given terms with their correct descriptions.
Q: Genetics Question 6
A: The objective of the question is to understand the concept of cloning and genetic inheritance in…
Q: Which is NOT true about Neanderthals? A) had large brains B) lived in caves C) used projectile…
A: The correct answer to which statement about Neanderthals is not true is C) used projectile weapons.…
Q: Which of these statements about bacteria are true? All of these are true Some of can breath metals…
A: The objective of the question is to verify the truthfulness of the given statements about bacteria.
Q: Which statement is NOT true about the early hominins: A) The angle of the foramen magnum on…
A: The objective of the question is to identify the statement that is not true about the early…
Q: Humans share almost 99% of our DNA with chimpanzees and bonobos. True or false?
A: The objective of the question is to verify the statement that humans share almost 99% of our DNA…
Q: = Q Set up Bacteria Growth Experiment 2024 Saved Search Design Layout References Mailings Review…
A: Here's a comprehensive discussion on how to set up such an experiment: 1. Define the Objective:…
Q: A certain ochre suppressor inserts glutamine in response to the ochre codon. What is the most likely…
A: In this scenario, where a suppressor mutation allows the insertion of glutamine instead of…
Q: I need help making changes to this essay using these research articles: Wood, H. L., Spicer, J. I.,…
A: The objective of the question is to revise the given essay using the information from the provided…
Q: Forensics Q1
A: In this scenario, the DNA gel analysis reveals genetic markers that are shared between both the wife…
Q: Please complete concept map for this activity. Concept Mapping activity, you will revise your…
A: Approach to solving the question: Detailed explanation:This concept map explores the interconnected…
Q: Genetics Question 14
A: The first suggestion for any future student taking this Genetics class would be to ensure they have…
Q: Liability for negligence includes all of the following except: Question 4 options:…
A: The question is asking us to identify which of the provided options is not a component of liability…
Q: I need help with this question please
A: During the G1 phase of the cell cycle, Cyclin-Dependent Kinase (CDK) complexes prepare for the…
Q: Genetics Question 10
A: We are using PCR (Polymerase Chain Reaction) and Gel Electrophoresis to analyze two specific genes…
Q: 10. Why should employers be especially careful about harassment when sponsoring social events such…
A: Employers should be especially careful about harassment when sponsoring social events such as…
Q: a. What are the linkage distances between m and r, between r and t, and between m and t?b. Determine…
A: The coefficient of coincidence signifies the degree of interference in a crossover event. A value…
Q: i need help woth this question
A: Step 1:The increase in pressure with depth in the ocean is given by the hydrostatic pressure…
Q: You are digging for fossils and found an ancient one with well preserved cellular contents. After…
A: The objective of the question is to identify the group of organisms to which a fossil belongs based…
Q: I need three paragraphs
A: In the thrilling adventure of survival at the secret location, I found myself surrounded by an…
Q: What was the most important idea of Lamarck's theory of evolution that contributed to Darwin's…
A: Detailed explanation: Lamarck's theory of evolution includes the idea that individuals could change…
Molecular Biology
Step by step
Solved in 2 steps
- 1. TRUE OR FALSE a) The genetic code in unambigous that means many codons can code for the same amino acids. b) There are no aminoacyl-tRNAs that will go to the A site of the ribosome when UGA is the codon.Which of these molecules has multiple partial charges and thus is most soluble in water? B H HHH HHH ABCD or E CH H CHOH D CH OH A cell is specialized in producing oil and steroid hormone. Which structure would be found in large r cell? O vacuoles O peroxisome O rough endoplasmic reticulum O smooth endoplasmic reticulum The oxygen released from photosynthesis results from: Reduction of NADP* to NADPH Chemiosmosis Oxidation of water PhotophosphorylationRefer to the Table of the Genetic Code and match the type of mutation to the following codon changes CUU --> CCU 1. Conservative GAA --> GAU 2. Missense UCA --> UAA 3. Nonsense 4. Synonymous CCU --> CCG > >
- 26. What is the start codon and the corresponding amino acid for which it codes? FIISI DASO U G UUU UUC UUA U CUU CUC CUA CUG AUA AUG GUU GUC GUA GUG PHE AUU AUC ILE GAU-ASP LEU MET or START LEU GUA-VAL AGU-SER VAL AUG- MET UCU UCC UCA UCG C CCUT CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Second base SER PRO THR ALA UAU UAC UAA UAG CAU CAC CAA CAG A GAUT GAC GAA 1 GAGJ STOP UGU TYR CYS UGC UGA STOP UGG TRP G HIS GLN AAC ASN AAA AAG J LYS ASP GLU G CGU CGC CGA CGGJ AGU AGC. AGA AGG GGU GGC GGA GGG >ARG SER ARG UCAG GLY UCAG UCAG UCAG THILD DASO REQUIRED E ce_______ are removed from new mRNAs. a. Introns c. Poly-A tails b. Exons d. Amino acids1. Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' a) Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. b) Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. c) Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. d) Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence. e) Draw the structure of the pertide fragment made up of the first five (5) amino acids in the given polypeptide.
- Give the complementary codons, anticodons, and amino acids for the following: - ATG - CCA-AGG-GCT - ACT Code: TAC-TCG-CGC-ACC-GTA-TGC Give the complementary code, anticodons, and amino acids for the following: Codon: AUG - UCA - UCU - CGU - UAC - CCU - GCC-ACU-GCA - CUG - UAG Give the complementary code, codons, and amino acids for the following: Anticodon : UAC – CUA – GAC – AUG – GGG – CAU – UGG – CCA – GCA – AUU Complete the following tables: CODE: T-A-C A-T-G C-C-G T-G-G A-A-T C-G-C A-T-T CODON: ANTICODON: AMINO ACID: CODE: CODON: ANTICODON: U-A-C A-U-G U-U-C C-G-A AMINO ACID: CODE: CODON: A-U-G ANTICODON AMINO ACID: T-T-A C-C-U A-U-C A-U-C C-C-U A-C-U C-U-G T-A-C U-A-G2. Transcribe the following gene sequence to the appropriate MRNA codons: TCA TTT CCA CAG ACA * AGU AAA GGU GUc UGU 3. Translate the mRNA codons (i.e. your answer to question 2) into the appropriate amino acids using the following Universal Genetic Code Chart. * Universal Genetic Code Chart Messenger RNA Codons and the Amino Acids for Which They Code SECOND BASE A UCU UAU UGU UUU UUC UUA PHE TYR CYS UCC UCA UAC UGC SER UAA UGA STOP LEU STOP UUG UGG} TRP UCG UAG CUU CCU CAU CGU HIS CUC CCC CAC CGC LEU PRO ARG CCA CCG CUA CAA CGA GLN CUG CAG CG AUU AUC ACU AAU AGU AGC AGA ASN SER ILE ACC AAC THR AAA AAGS ACA AUA AUG MET or START LYS ARG ACG AGG S GCU GCC GUU GAU GGU ASP GUC GAC GGC VAL ALA GLY GUA GCA GCG GAA GGA GGG GLU GUG GAG トエーCロ ASE A, L-RST BASE6. Similar to the class notes (Intro to Genetics), a segment of DNA (shown below) contains a promoter segment (the first 9 base pairs), a ribosome binding segment (the next 6 base pairs), and a segment that codes for protein synthesis which is started by the rest of the base pairs. ACTCCATTGAACCATTTCTATGATCCGCTAACG-... TGAGGTAACTTGGTAAAGATACTAGGCGATTGC-... A. When the DNA is induced to be copied to mRNA, the top strand is coding, meaning that the mRNA makes an identical copy of the lower strand (replacing T with U) The mRNA copy starts with the ribosome binding sequence. What is the sequence of the mRNA that will go to the ribosomes? B. What are the first 6 amino acids of the protein that are coded for by the mRNA? C. What would the amino acid sequence be if... i. a transition mutation occurred on the final G in the mRNA? ii. all of the G & C bases in the protein synthesis portion had transition mutations? iii. a point deletion mutation occurred in the ATA sequence (in the lower strand…
- AAG ATA CAG GCT CGG TAA For the DNA sequence shown above, identify the following: a. mRNA codons b. tRAN anticodons c. amino acidsGiven Sequence: 3’ – TACGGACTGATAGGCCCGCGCATC-5’ a.Complementary Strand: b. Direct Transcript: c. Transcript for Translation: d.Translated Amino Acid Sequence:1. The following is the DNA sequence of a gene: 3' TACTAACTTAGCCTCGCATC S' a. What amino acids are coded by this sequence? b. An adenine is inserted in this strand after the first guanine from the left. The resulting polypeptide is six amino acids long. Where is the newly produced nonsense codon located? What is the amino acid sequence in the fragment?