Below are fragments from a shotgun sequencing run of a single chromosome. On a separate piece of paper, align the four sequences as best you can using nucleotide overlaps. NOTE: an overlap of only 1 nucleotide is not considered sufficient for building an alignment. How many contigs are represented by these sequences, onc aligned? 5'TGGAATTTCA 5'GTGGAATT 5'AGTGG 5'GCATGCA 4

Below are fragments from a shotgun sequencing run of a single chromosome. On a separate piece of paper, align the four sequences as best you can using nucleotide overlaps. NOTE: an overlap of only 1 nucleotide is not considered sufficient for building an alignment. How many contigs are represented by these sequences, onc aligned? 5'TGGAATTTCA 5'GTGGAATT 5'AGTGG 5'GCATGCA 4

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Similar questions

Below are 9 possible primer pairs.● Determine which primer pair is the best choice.● Explain why the other primers are not good choices.● Calculate the Tm for each primer. Underline or highlight the region of DNA for the primer pair you chose as the best.Forward 1: 5’ gaaataattttgtttaactttaag 3’ Tm =Reverse 1: 5’ gtttaagacaaaatagtctgg 3’ Tm =Forward 2: 5’ gtaactcagctttcaggtcg 3’ Tm =Reverse 2: 5’ tctcggaatgttgcaacagc 3’ Tm =Forward 3: 5’ agattagcggatcctacctg 3’ Tm =Reverse 3: 5’ atgtgtaatcccagcagcag 3’ Tm =Forward 4: 5’ cattgattatttgcacggcg 3’ Tm =Reverse 4: 5’ aaaatcttctctcatccgcc 3’ Tm =Forward 5: 5’ tccataagattagcggatcc 3’ Tm =Reverse 5: 5’ tgcaagcttggctgttttgg 3’ Tm =Forward 6: 5’ gatcctacctgacgcttttta 3’ Tm=Reverse 6: 5’ aaataatgaattcgagctcggt 3’ Tm =Forward 7: 5’ataaaaaaatcgagataaccgtt 3’ Tm =Reverse 7: 5’aggtcgactctagaggatc 3’ Tm =Forward 8: 5’ctacctgttccatggccaac 3’ Tm=Reverse 8: 5’ ttcgggcatggcactcttg 3’ Tm=Forward 9: 5’ tccataagattagcggatcc 3’ Tm =Reverse 9: 5’…
In a genome project, the following genomic DNA sequences were obtained. Assemble the sequences into a contig. Using the assembled sequence, perform a BLASTn search. Does the search produce sequences similar to your assembled sequence? 5’ TCGGGGTCCTGGGATCTCATCACTGCAGCGC 3’ 5’ACTGCAGCGCTTTCCCAGCGGGCGGTGGTAC 3’ 5’GGGCGGTGGTACTCGGGAAGTCAGGAGTGTT 3’ 5’AGGAGTGTTTAAAACCTGGGGACTGGTTTTG 3’ 5’TGGTTTTGGGGGCGCTGAAGGCAGCGCAGGA 3’
There are numerous methods for sequencing DNA, including classical Sanger sequencing, automated Sanger sequencing, and next-generation sequencing technologies, including Illumina technology. Match the modified cytidine nucleotide triphosphates (NTPs) with DNA sequencing methods that utilize them. Classical Sanger sequencing HO-P=O O HO-P=O O HO-P=O O Automated Sanger sequencing -NH₂ CH3 H₂CN ° ? ?N HOOOO OH OH OH NH CH₂ Next-generation DNA sequencing (Illumina) CH₂ NH₂ Answer Bank
In the following gel showing stained bands of the Alu insertion sequence, what is the genotype of individual 2? 941 bp 641 bp->>> 1 2 3 4 5 6 Homozygous for the 641 bp sequence that does not contain in the Alu insertion Heterozygous, containing one 941 bp sequence and one 641 bp sequence O Homozygous for the 941 bp sequence containing the Alu insertion
Design a pair of primers to amplify the entire length of the following 45 base pair sequence.Make each primer 14 bases long. Write the sequences of the primers in 5' to 3' order.(Hint: It will help for you to write out BOTH strands of the DNA sequence listed below.5'-GATGCCCGTTGGATAAATTGGGCGTCTAGAATCGGTCACACTTAG-3'
If you had the RNA sequence below: 5'UUUGGAG 3' and you were going to make a piece of DNA that would be a complement to it, what would the DNA sequence be? 5' 3' What 12-nucleotide primer would you use in the PCR technique when you want to amplify a gene whose end is as follows: 3' CGGCTCGACAAGGTG5' ? 5' 3'
For the following short sequence of double stranded DNA and the given primers, there will be one major duplex DNA product after many cycles (imagine 10 cycles) of PCR. Provide the sequence of this one major duplex product and label the 5’ and 3’ ends of each strand. Sequence to be amplified: 5’- GGTATTGGCTACTTACTGGCATCG- 3’ 3’- CCATAACCGATGAATGACCGTAGC- 5’ Primers: 5’-TGGC-3’ and 5’-TGCC-3’
In a standard procedire, when writing and reading base sequences for nucleic acids (both DNA and RNAs) always to specify base sequence in 5' > 3' direction unless otherwise directed 1. From the base sequence 5' A-T-G-C-C-A 3' in a DNA template strand, determine the base sequence in hnRNA synthesized from the DNA template strand 2. From the base sequence 5' T-A-A- C-C-T 3' in a DNA template strand, determine the base sequence in hnRNA synthesized from the DNA template strand
Table I CACGT A GA CTGAGG ACTC CACGTAGACTGAG G ACAC Wild-type beta-globin gene fragment Sickle-cell beta-globin gene fragment > Circle the mutation in DNA of the sickle-cell beta-globin gene fragment Compare fragments of DNA the wild-type and mutant beta-globin genes in the Table I above, what are the similarities and differences you observe?
Using the first and second base key below, predict the DNA sequence given by the SOLID color sequence. For the key G = green, R = red, Y = yellow, and B = blue. Note that the first base of the sequence is already given ("A"). Give the remaining 8 bases for this sequence. A First base A CCT Second base A CGT BGY R GBRY RBG R Y (G) B Y G)(R) GB )( R )( Y ) ( G) B
What is the role of di-deoxy DNTPs in a Sanger sequencing reaction? Please select the answer that is most correct. The di-deoxy DNTPs are incorporated into the growing DNA molecule. The di-deoxy DNTPs terminate polymerisation of the growing DNA molecule, thereby creating fragments which all end in that specific di-deoxy base. Subsequent separation of the fragments by size facilitates the ascertainment of the sequence. The di-deoxy DNTPs facilitate polymerisation of the growing DNA molecule. this allows for multiple copies fo the template to be made for further analysis. The di-deoxy DNTPs terminate polymerisation of the growing DNA molecule. Ending the replication ensures that the molecules are not too long to be sequenced.
A molecular biologist is investigating homologous recombination. One aim of this study is to reconstitute stages of the process in vitro. (a) Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a stable model Holliday junction. W 5’ GATCGCATTGTAGCCGTAGGTCCACTGTAA 3’ X 5’ GTCCCATACGTAGCCGTAGGACATGTACCG 3’ Y 5’ CGGTACATGTCCTACGGCTACAATGCGATC 3’ Z 5’ TTACAGTGGACCTACGGCTACGTATGGGAC 3’ (b) What is branch migration? (c) What is the name of the enzyme that resolves a Holliday junction into two separate DNA duplexes? (d) On your diagram, indicate how the Holliday junction can be resolved in two different ways and draw the structures of the products.