Br Br OCH3 Br Br Br Br da "OH 'Br NBS DMSO, H₂O OH Br "OH Br Br CH3CH₂OH H₂SO4 [1] BH3 Br Br "OH OH Br OCH₂CH₂ Br OCH₂CH [2] H2O2, HO [1] 9-BBN [2] H2O2, HO a OH Br OH "Br
Q: Draw a Haworth project of a common cyclic form of this monosaccharide:
A: The aldohexose (6-Carbon aldose) is an L-Mannose.It was determined as a sugar in L-form since its…
Q: Be sure to answer all parts. Nitrogen dioxide decomposes according to the reaction 2 NO2(g) 2 NO(g)…
A: Step 1: The ICE table for the given reaction can be constructed as 2 NO2 (g)2 NO (g)O2…
Q: Michael: NaOH Η 요요 NaOH O: ά
A: In case of any doubt feel free to ask.
Q: Write the Equilibrium Expression for each of the three reactions below 1) CH4(g) + 2O2(g) →…
A: EXPLAINED ABOVE
Q: Use bond energies to calculate the heat of reaction: :ɑ—C:+ H—H Round your answer to 3 significant…
A: Step 1: We know that, Heat of reaction can be calculated by using formula as ΔH = ∆H (bond broken)…
Q: 1.) Calculate the pH of 1.20 molar solution of NaF. Write the hydrolysis reaction first. 2.) 20.0mL…
A: Approach to solving the question: Hydrolysis reactions always involve water. Since this is acid-base…
Q: When the Cu2+ concentration is 1.11 M, the observed cell potential at 298K for an electrochemical…
A:
Q: Draw the arrow pushing mechanism for the transfer hydrogenation converting dehydrozingerone to…
A:
Q: Please don't provide handwritten solution.
A:
Q: a segment of dna has the following sequences of bases ATGCAATGATATTGAAGCTTA
A: The DNA segment you've provided, "ATGCAATGATATTGAAGCTTA," is composed of nucleotide bases. These…
Q: 17. What is the Aldol addition product formed from reaction of the following compound with itself? О…
A:
Q: Why does product A form faster than product B? (three correct answers) KCI + KOH KOH КСІ + H₂O…
A:
Q: Ethyl bromide is synthesized by reacting ethylene with hydrogen bromide. H H:Br: C=C X H + H-Br: Н…
A: Step 1: In the given question bond energy values are taken as a standard values Step 2:bond energy…
Q: Please don't provide handwritten solution ....
A: Hydrolysis reaction definitionIn a hydrolysis reaction, the water is used to break down the chemical…
Q: Click in the answer box to activate the palette. 212 Write the balanced nuclear equation for a decay…
A: The steps to write a balanced nuclear equation for the alpha decay of 212Bi. Step 1: Identify the…
Q: Mr. Gill is attempting to grow some new flowers at home. He knows that flowers and plants alike…
A: Approach to solvinquestion: explanation:s:
Q: please answer in text form and in proper format answer with must explanation , calculation for each…
A: EXPLAINED ABOVE IN DETAILED
Q: Which of the following could trans-1,2-diethoxycyclopentane be directly synthesized from? C O HO HO…
A: Step 1: Information: The given question is based on retro synthetic analysis.In the retro synthetic…
Q: For this question: How SPF blocks UV Rays from the sun please provide a link of a 1 minute video…
A: UV rays, or ultraviolet rays, are a form of electromagnetic radiation emitted by the sun. They have…
Q: 5 5. Solid iron (III) hydroxide, Fe(OH)3 (s), will dissolve in acidic solution. Explain why by…
A: a)The compound, Fe(OH)3 consists of Fe3+(cation) and OH- (anion) ions. When the compound…
Q: Predict the major products of the following reaction. Be sure to show the stereochemistry of the…
A: Step 1: Step 2:Mechanism Step 3: Step 4:
Q: Water of Hydration Record the mass empty evaporating dish ( or crucible). Record the mass of dish…
A: Step 1: **Determine the mass of water lost** * Evaporating dish mass = 29.00 g. * The dish mass…
Q: Rank each set of substituents using the Cahn-Ingold-Prelog sequence rules by numbering the highest…
A: Step 1:
Q: Question 2. A homeowner uses 4.00 x 103 m3 of natural gas in a year to heat ahome. Assume that…
A:
Q: Calculate the pH of a solution that is 0.215M benzoic acid and 0.190M sodium benzoate, a salt whose…
A:
Q: Calculate enthalpy of the reaction below using Hess' Law. 2CO(g) + O2(g) → 2CO2(g) 4H = ? C(s) +…
A: Step 1:
Q: 1016 3. Using Hess' Law, Calculate the standard heat of formation of copper(I) oxide given the…
A: Step 1:Introduction to question :Given ,Reaction 1 : CuO(s) → Cu(s) + ½ O2(g) Δ.Η° = 157.3…
Q: Calculate the pH at the equivalence point in titration 0.100 M solutions of each of the following…
A: Step 1:Step 2:
Q: QUESTION 4 your choice. .ank the following compounds below In terms of acidity and explain CF3CH2OH…
A: Step 1: We know, According to Bronsted-Lowry acid-base theory, an Acid is a H+ donor whereas a Base…
Q: Draw skeletal structure corresponding to each IUPAC name 1,2-dimethylcyclopentene 6-ethyl-2-octyne…
A: Step 1:(A) 1,2-dimethylcyclopentene:There is a cyclic pentene with a double bond as a functional…
Q: Show steps how to get the amount of error (Pduration - Pmarket) for second question in the picture,…
A: Answer to 9b-20:b. -$0.75Here's why:Duration: We don't need the exact duration value for this…
Q: = O Kinetics and Equilibrium 2/5 Bi Calculating an equilibrium constant from a heterogeneous…
A: Given: V=8.3Lmass,gMolarmass,g/mol2Hg(l)7.2200.59+O2(g)15.432.00→2HgO(s)11.7216.59Step 1:…
Q: 1. Why is the soap translucent? 2. What helps the soap retain its water content? 3. Draw a…
A: Figure showing the soap molecules. parts of gold from japand diamonds. REFERENCE: 5.2: Soap -…
Q: Problem 68 of 80 Submit Draw the product of the reaction shown below. Ignore inorganic byproducts.…
A:
Q: An arctic weather balloon is filled with 40.3 L of helium gas inside a prep shed. The temperature…
A: Approach to solving the question:Please see attached photos for detailed solutions. Thank you.…
Q: O Kinetics and Equilibrium Calculating an equilibrium constant from a heterogeneous equilibrium...…
A: Step 1:Introduction to question :Given ,Reaction : CaCO3 (s)→CaO(s)+CO2(g)Objective : Calculate the…
Q: ← Problem 23 of 37 Submit Draw the Fischer projection from the Haworth projection shown below. CH2OH…
A: Step 1: Step 2: Step 3: Step 4:
Q: :&;$;$:$$:$$;$;
A: It seems like you're describing a series of reactions involving bromine (Br2) under various…
Q: Ethyl bromide is synthesized by reacting ethylene with hydrogen bromide. H H C=C + H-Br: H H H:Br:…
A: Step 1: GivenH2C=CH2 + HBr → H3C-CH2-BrBondEnergy (kJ/mol)C-H413C=C602H-Br366C-C370C-Br293 Step 2:…
Q: (CH3)3N+ CH₂I acetone
A:
Q: Calculate Grxn at 298 K under the conditions shown below for the following reaction. 5)3 O2(g) → 2…
A:
Q: During an experiment, 0.984 mol of H2 and 0.492 mol of 12 were placed into a 1.38 liter vessel where…
A: To calculate the final (equilibrium) concentrations of H2, I2, and HI, use ICE table to relate…
Q: 4. Assign E or Z configuration to the following compounds. H3C CH2CH3 a) H3CH2C CH2CH2CI H₂C CH₂Br…
A: In case of any doubt feel free to ask.
Q: 5. Assign R,S configuration to the following molecule. HOOC Br H3C a) H H₂N CH3 NC... b) H c) H…
A: Approach to solving the question:R and S nomenclature is used to define the stereochemical…
Q: Predict the product(s) for each reaction below
A: This are the products for the given reaction. Hope this helps, thank you!
Q: An atomic absorption spectroscopy analysis provided the following data for the analysis of Cu in a…
A: Step 1:Absorbance is the dependent variable; it is placed on y-axis.Concentration is independent…
Q: :$;);););):):$;$;
A: Step 1:Since the allylic or benzylic radical intermediates are more stable than non-conjugated C…
Q: Draw the most stable conformation of cis-1-isopropyl-3-methylcyclohexane.
A: **Step 1: Understanding the Structure**Cis-1-isopropyl-3-methylcyclohexane has two substituents:- An…
Q: Please Write SteP by Step Answer Otherwise I give you DISLIKES !
A: Step 1: Step 2: Step 3: Step 4:
Q: please answer in text form and in proper format answer with must explanation , calculation for each…
A: Step 1: Aldol Condensation :Two molecules of an aldehyde or a ketone, containing at least one…
Step by step
Solved in 2 steps with 1 images
- OH ZI O NaOCI, Nal EtanolОН ОН ОН 1) CH;CH,Li 2) NH,CI (aq)Atoms in Element 1 Atoms in Element 2 Atoms in Element 3 Atoms in Element 4 Total Atoms in Molecule Total Elements in Molecule Molecule 2 2H20 4 3CO2 3 6. 9H3PO4 27 36 72 0. 6. 1 20 4 12 20 3. 5Bas(PO4)2 15 10 40 40 105 4 2(NH2S 16 22 4Fes(SOaa 12 12 36 60 3AI(HCO.)a 3 9. 27 48 12 6. 24 42 4 10M9SO. 10 10 40 60 5NaPO. 15 5 20 60 3 7M93(PO4)2 21 14 56 91 8(NH.)PO. 24 96 8 32 160 4 4NaHCO, 4 4 12 9KCIO, 9. 9. 27 45 3 2Ca(CIO.)2 2 4 12 18 3 12Ca (PO4)2 11Ca(NO3)2 7AI(OH). 24
- Complete the balanced molecular chemical equation for the reaction below. If no reaction occurs, write NR after the reaction arrow. Be sure to include the proper phases for all species within the reaction. (NH,),SO,(aq) + BaCl,(aq) - 24 2 W S X # 3 E D C 1 80 F3 + 4 2 R 0₂ NH F Reset ( ) O 3 V 22 % 5 T G 4 04 ->> H Ba SO 6 B 5 6 Y 5 H + ²+ ³+ & 7 tv 6 ☐ N (s) N CI NR 44 7 8 9 U J * 00 x H₂O ☐8 09 (1) (g) 8 04+ DII FB I M S Be ( 9 Delete O K 0 口。 (aq) DD F9 O ) O O F10 L P 8 V 3 F F11 { FIn drawing Lewis structures, we learn that a hydrogen atom forms only one bond in a covalent compound. Why?hyrw 2o nsn hyapsn sem St.) Calcium oxide is sometimes very challenging to etare n the Oumistry labrortory.This compound reacts with moisture in the air and is converted to calcium hydcokide. If a bottle of calcium oxide i8 left on the ehelf too long, it grodually absorbs moisture from the humidity in the laboratory. Eventually th bottle cracks and spills the colcium hydrokide that hus been produced. WrHhe the unbalancaed chemical equaher for this process. 33.) The clement tin often occurs in nature as the oxide, Sn b produce pure tin metal from this sort of tin oe, the ore Gtmol rom the usually is heated with coal Carbon) This produies pure