Consider the tripeptide phenylalanylcysteyl methionine. Part: 0 / 2 Part 1 of 2 Draw the structure of this tripeptide at physiological pH. Click and drag to start drawing a structure. : ☐
Q: Identify the major and minor grooves in the DNA molecule PDB ID 141D. In addition, one end of a…
A: The DNA double helix has alternating major and minor grooves. The major groove is wider than the…
Q: DRAW ON PAPER PLEASE - Amylose is a linear polymer of several thousand glucose units linked by (14)…
A: Amylose is a polysaccharide. It is made up of -D-glucose residues linked via (14) glycosidic linkage…
Q: Ringlemann scale is used to analyze O a. Carbon monoxide Ob. Nitrogen dioxide O c. hydrocarbons O d.…
A: The objective of the question is to identify the substance that the Ringlemann scale is used to…
Q: You have expressed a protein of interest in E. coli cells for further study in the lab. The protein…
A: One possible purification scheme for the protein of interest might include the following steps:1.…
Q: Please help me fill in all the information
A: 1. **Conversion of Pyruvate to Acetyl-CoA**: - **Pyruvate Dehydrogenase Complex**: This complex of…
Q: Two of the bypass reactions of gluconeogenesis involve: phosphorylation of the metabolite using…
A: Gluconeogenesis is a metabolic pathway that allows the generation of glucose from non-carbohydrate…
Q: To which class of lipid does the molecule below belong? OH HO OH H ...CH 3 H O eicosanoid O…
A: The objective of the question is to determine which category does the given molecule belongs.
Q: Given that the protein Burger is found only in the blood of patients with Sillyitis, with the aid of…
A: The Enzyme-Linked Immunosorbent Assay (ELISA) is a powerful technique used to detect and quantify…
Q: 5'-AATGCCTCAGCCGATCTGCCTCGAGTCAATCGA TGCTGGTAACTTGGGGTATAAAGCTTACCCATGGTATCGTAG…
A: PCR is a lab technique used for amplification of target DNA sequence by using a thermostable DNA…
Q: What is the effect of each of the 4 types of inhibitors on the initial rate of an enzyme catalyzed…
A: Inhibitors of enzyme catalyzed reactions are broadly classified into reversible and irreversible…
Q: Predict the product(s) of the following reaction. H H NaOH, EtOH heat HO E + Z isomers A E + Z…
A: Approach to solving the question: Detailed explanation:In the first step, an enolate ion is formed…
Q: Label each Amine (A–D) in Table 1 as primary, secondary, or tertiary. Which classes of amines –…
A: Good evening,Hope this helps, Thank you!Explanation:Approach to solving the question: Detailed…
Q: Melting Temperature (Tm) of a dsDNA molecule is the temperature at which a 100% of…
A: The correct answer is:c. 50% of the dsDNA exists in a single-stranded (denatured) form.…
Q: Draw the product AND propose a reasonable, detailed stepwise mechanism, using curved arrow notation…
A: here in first step in presence of base H+ ion is removed from alpha position of carbonyl carbon and…
Q: 111: 900 Page 3 (b) Construct an energy-level diagram of 2-pentene showing the relative energy…
A: Already done Explanation:Step 1: Step 2: Step 3: Step 4:
Q: 2. The mature form of TEM-1 ß-lactamase, an enzyme of 290 amino acid residues that hydrolyzes…
A: Before calculating the isoelectric point (pI) of the enzyme, we need to be thorough with the…
Q: Reverse translate the sequence of insulin pasted…
A: To reverse translate the given sequence of insulin and optimize the codons for Homo sapiens and…
Q: Please show your work and write it out
A: To answer these questions comprehensively, let's break down the process of glucose production in a…
Q: Genetics Question 8
A: The objective of the question is to identify the correct event that occurs during the prophase of…
Q: Question 3
A: The question is asking about the structure of DNA and what parts of the DNA strands are connected by…
Q: An π helix can be described as a 4.4 helix. Explain 16 what this designation means. Given the pitch…
A: ●A π helix is a type of secondary structure found in proteins.The amino acids in a standard π-helix…
Q: 5. Trehalose, a disaccharide produced in fungi, has the following structure: CH₂OH H OH H H H H OH H…
A: a. α-D-glucopyranosyl-(1→1)-α-D-glucopyranoside b. Trehalose is not a reducing sugar.Explanation:…
Q: please explain the question, i am unable to input values of x
A: The dependent variable, the reaction rate (µmol/L/min), is usually plotted on the y-axis and is…
Q: An enzyme is mutated such that the KM of the mutated enzyme is lower than the KM of the original…
A: The objective of the question is to understand the effects of a mutation that lowers the KM of an…
Q: The kinetic data in the following table were obtained for the reaction of carbon dioxide and water…
A: The substrate affinity of CO2 for carbonic anhydrase or Km is found to be 10 mM.Explanation:Step 1:…
Q: 1. Draw the structure of an omega-3 fatty acid, docosahexaenoic acid (DHA, 22:6 (4,7, 10, 13, 16,…
A: The structural formula of DHA can be represented as follows:CH3 - CH2 - CH = CH - CH2 - CH = CH -…
Q: BIOMOLECULES - Please answer the questions properly. - Multiple choice 1. Which of the following…
A: OPTION A : It outlines an enzymatic two-step mechanism that converts AMP to ADP and subsequently ADP…
Q: What is(are) the only active site(s) not used in the second round of fatty acid synthase? Select all…
A: Here's a breakdown of why these are not used in the second round: Acetyl-CoA ACP Transacylase: This…
Q: 2. Shown below is a dipeptide. HN- HO. OH a. Over which pH range will the dipeptide predominantly…
A: An amino acid is a biomolecule with a hydrogen atom, an amino group, a carboxyl group and a…
Q: 2. Draw the ringed form of D-glucose with the following modifications: (a) Convert to sugar acid at…
A: Below answer given Explanation:Step 1:(A) Step 2:(B)(C)&(D) Step 3: Step 4:
Q: Which statements describe electron transport chain events? > NADH releases two hydrogen ions and…
A: The electron transport chain is a system of four protein complexes that oxidise NADH/FADH2 and…
Q: If someone's pH increases above 7.8, they die. How much would the % buffer have to shift from normal…
A: The usual pH range for blood is 7.35 to 7.45. The body's buffering systems, such as the phosphate…
Q: You have a crude lysate sample (CL) containing a mixture of six proteins (1, 2, 3, 4, 5, ẞ-…
A: Proteins precipitate at specific concentrations of various salts. The concentration of salt required…
Q: 80.00 mL of 0.350 M benzoic acid (K = 6.4×105) is titrated by 0.350 M NaOH. Calculate the pH of the…
A: Benzoic acid (C6H5COOH) is a weak acid with a dissociation constant (Ka) of 6.4 × 10-5. When it…
Q: Under extensive energy needs cells are constantly converting sugar into CO2 as a result of cellular…
A: During cellular respiration, cells convert sugar into carbon dioxide (CO2) and other byproducts.…
Q: You are working as a protein engineer. You decide to work on lacl protein ( This is the repressor…
A: An operon is a cluster of genes under a single promoter. The gene products of genes in an operon are…
Q: With the ninhydrin method, it was determined that an acyclic decapeptide consists of the following…
A: Elastase cleaves the peptide bonds formed by small hydrophobic amino acids, towards the C-terminal…
Q: None
A: To correctly match the terms with their appropriate properties, we need to examine each term and…
Q: What is the major organic product obtained from the following reaction? CH3 2 4 3 1 (CH3)2C=CH2 HF…
A: Step 1:
Q: The student advises using the same selection procedures and inoculating a 5 mL overnight culture…
A: Quantification: The process of plating on agar plates enables the counting of individual colonies,…
Q: why do so many pharmaceutical drugs contain nitrogen? How would an NH2 group benefit this dimer…
A: The objective of the question is to find the reason why so many pharmaceutical drugs contain…
Q: You have a racemic mixture of d-2-butanol and l-2-butanol. The d isomer rotates polarized light by…
A: The objective of this question is to determine the rotation of the polarization of light of a…
Q: -22 2. (10 pts) Overlapping part of wave function of C-O bond (from to + in x-axis) is expressed by:…
A: The detailed ans has been attached. Explanation:
Q: Describe how the shape and size of nucleotides are important in the structure of double-stranded…
A: Nucleotides that make up DNA are composed of 3 components; a deoxy ribose sugar, a phosphate and a…
Q: Consider the following Peptide: Alanine-Lysine-Glutamine-Serine-Glycine Select all that applies Give…
A: Peptides are short chain of amino acids linked by peptide bonds. Amino acids that have been…
Q: In three sentences describe how Sanger sequencing works
A: Copying DNA: To determine the sequence of DNA, scientists start by making many copies of the DNA…
Q: You are observing the translation process in a eukaryotic cell that has been exposed to an unknown…
A: Translation is the process by which the genetic information encoded in mRNA is used to synthesize…
Q: 3. Acetylcholinesterase is a serine hydrolase enzyme im- portant in nerve signal transmission,…
A: Approach to solving the question: Enzyme reactions. Detailed explanation:1. here's an arrow-pushing…
Q: How is plasmid DNA distinguished from coli chromosomal DNA using the Qiagen Miniprep protocol?
A: In the Qiagen Miniprep protocol, plasmid DNA is distinguished from E. coli chromosomal DNA based on…
Q: Genetics Question 17
A: The question is asking whether the number of sister chromatids in a cell at metaphase of meiosis 1…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 4 images
- A 100 ml solution of 0.1 M amino acid (AA) at ph 1.0 was titrated with NaOH solution. The pH was monitored, and the results were plotted on the graph. The keypoints in the titration are designated I to VII. What is the possible identity of the amino acid? What is the isoelectric point of AA? what is the pKa corresponding to the dissociation of the alpha carboxylic group? Region/point where AA is predominantly present as a (-1) charged species? The effective buffering range for the amino acid in the acidic region? Region/point where the solution has 50:50 percent mixture of the (0) and (-1) speciesDraw the titrimetric profile of tyrosine and calculate its isoelectric pHAn oligopeptide has the following amino acid sequence: NH2-Ala-Glu–Leu–Trp–Tyr-Ser–Gly–Lys–Leu-Ala–Arg-Ala-Phe-Ile-Pro–Gly-COOH a) Estimate the net electric charge of the molecule at pH 8.0 and pH 11.0. b) If the above peptide is passed through a cation exchange chromatographic column (that is, the matrix of the column has negative charges) stabilized at pH 8.0, would you expect it to be retained on the column? c) Indicates the number of fragments, and the sequence of each of them, that would be obtained when treating the peptide in question with: i) trypsin, ii) chymotrypsin.
- The melanocyte-stimulating peptide hormone a-melanotropin has the following sequence:Ser–Tyr–Ser–Met–Glu–His–Phe–Arg–Trp–Gly–Lys–Pro–Val(a) Write the sequence using the one-letter abbreviations.(b) Calculate the molecular weight of a-melanotropin, using data inTableThe melanocyte-stimulating peptide hormone α-melanotropin has the following sequence: Ser–Tyr–Ser–Met–Glu–His–Phe–Arg–Trp–Gly–Lys–Pro–Val(a) Write the sequence using the one-letter abbreviations.(b) Calculate the molecular weight of α-melanotropin, using data in as shown.80mL of a 0.3M solution of hexapeptide Leu-His-Cys-Glu-Asn-Arg is adjusted to pH=pl. The solution is then titrated with 0.2M HCI to a final pH of 2.1. Sketch the titration curve, labelling the pH and volume axes. Indicate the volume of HCl needed to reach each relevant pKa value and equivalence point(s). Relevant pka values are: 2.1, 4.3, 6.0, 8.3, 9.8, and 12.5.
- Consider the following protein mixture: Protein A B C D Molecular Weight (kDa) 50 150 200 350 Affinity to Metal ion === Zn²+ === 1. Using hydrophobic interaction chromatography, the protein that will be eluted last is [Select] 2. Using affinity chromatography, the protein that will be eluted last in a Zn²+-containing column is 3. The protein with the fastest migration towards the anode in SDS-PAGE is [Select] IpH value 7 3 9 5 [Select] [Select] 4. Using a buffer solution with a pH of 4, the protein that will bind to an anion exchanger is 5. The protein that will be eluted last in a gel filtration column is [Select] 6. Using isoelectric focusing, the protein that will have a protein band nearest to the cathode (negative electrode) is [Select] % Hydrophobicity 20 45 75 55When separated on a polyacrylamide gel, the procedure is abbreviated as SDS-PAGE (Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis). The technique is a standard means for separating proteins according to their molecular weight. The gels are neutral, hydrophilic, three-dimensional networks of long hydrocarbons cross-linked by methylene groups. (Give the main two compounds responsible for the formation of the gels)The following proteins were separated by SDS-PAGE in the presence of mercaptoethanol. Sketch the relative positions of the various polypeptides on the gel. Label the positive and negative ends of the gel.Protein A: 40 kDa single polypeptideProtein B: 80 kDa protein, made up of two subunits of molecular weight 20 kDa and 60 kDa, held together by noncovalent interactionsProtein C: 200 kDa protein, made up of four identical subunits (50 kDa each) linked together by disulfide bonds
- Please draw a single polypeptide chain structure that has the following amino acids (leucine, alanine, cystine, argenine, glutomine, and leucine) as it would appear at physiological pH. Calculate the pl of the polypeptide. I will rate!A tetrapeptide, glutamate-glycine-alanine-lysine, is prepared at at concentration of 1 mM (0.001 M) and is measured in the standard setup (pathlength of 1 cm). What is the approximate absorbance of this peptide at 280 nm? Hint: if the peptide contained a single tryptophan, the answer would be about 10. 10 280 1 0Draw the structure of histidylthreonine, a dipeptide made from histidine and threonine, as it would appear at physiological pH. Explanation Click and drag to start drawing a structure. Chock 0, X 0 :0 E Ahm