Describe and discuss 24-hour Dietary Recall , Food Frequency Questionnaire and 3-day Food Record. Compare its advantages and disadvantages

Q: A benefit/benefits of vaccination is that a child will O protect other children who cannot be…

A: Answer : the benefits of vaccinations is that Child will are :    develops antibodies through…

Q: Match the chemotherapeutic agents with their use, side effects etc. Pareo. Match chemotherapeutic…

A: As per Bartleby policy i can solve only first three parts dear student.

Q: 3. How is population growth depicted? 4. What are the applications of knowing limits to population…

A: Ecosystems provide foods, medicines, and energy, they regulate nutrient recycling and waste, they…

Q: Give examples, names the three main inflorenscene types of grasses

A: A group or cluster of flowers formed on a stem made of a primary branch or a sophisticated pattern…

Q: A certain cDNA of size 2 kb hybridized to eight genomicfragments of total size 30 kb and contained…

A: Introduction :- In the presence of reverse transcriptase, cDNA is a complementary DNA to a given RNA…

Q: Reproduction is usually sexual with both male and female sexes, however asexual reproduction does…

A: Reproduction It is a process leading to the formation of an organism that may or may not be similar…

Q: What is the purpose of generating a phenocopy?

A: The phenocopy phenomenon is easily translated and is used for the process of drug discovery. This is…

Q: A benefit/benefits of vaccination is that a child will develop antibodies through natural immunity…

A: Vaccinations and Immunizations started in the 18th century, with the Smallpox Vaccination, created…

Q: Why is the epithelial tissue characterized as polar sheets? answer and explain

A: INTRODUCTION Tissues are the groups of cells that perform a particular or similar function in the…

Q: Explain how epigenetic changes can contribute to tumorigenesis.

A: Tumors are clumps of cells formed by uncontrollable cell division. Tumorigenesis is the uncontrolled…

Q: Explain "Numerical taxonomy" briefly.

A: Introduction In this question we will explain the Numerical taxonomy.

Q: factor dimers, results in the phosphorylation of an array of tyrosine residues present in…

A: The JAK-STAT signaling pathway is a chain of interactions between proteins in a cell, and is…

Q: A critique is a genre of academic writing that briefly summarizes and critically evaluates a work or…

A: Critique analysis is evaluation of text, it is subjective writing. The purpose of critique is to…

Q: Arthropods are distinguished by having an exoskeleton andlacking external cilia. How do these traits…

A: The exoskeleton is the hard chitinous covering that covers the body of insects and prevents it from…

Q: Given the DNA strand with sequence 5' AUGGAGGAUGGCCAGUCAAUUUGA 3' match the various mutations to the…

A: Codon is a sequence of three nucleotides that corresponds to a specific amino acid. Codons encode…

Q: One of the most widely used means of communication among insects is chemical communication. How do…

A: Pheromones is a chemical released by an animal which ultimately changes the behaviour of a another…

Q: ion ) parenchyma

A: Plant cells are photosynthetic eukaryotes. These belongs to the kingdom Plantae.

Q: Compare and contrast anthropocentrism, biocentrism, and ecocentrism. Explain how individuals with…

A: Anthropocentrism is defined as the people who have a human-centered view of a relationship with the…

Q: 11. Choose from the following types of inheritance and write in the 1st column which one is…

A: Alleles are the alternative forms of a gene, that are located on the same locus of homologous…

Q: What is the difference between forward and reversegenetics?

A: The study of genes is known as genetics. Our genes contain information that is passed down from…

Q: 1. What are the target cells of SARS-CoV-2? What do these cells have in common?

A: Many scietific studies have confirmed that SARS-CoV-2's spike protein attaches to…

Q: _______________ refers to the chance that a disease genotype produces a disease phenotype.

A: The phenotype can be described as an organism's visible physical features, such as its structure,…

Q: Explain sexual reproduction in bacteria?

A: Despite the fact that bacteria do not have true sexual reproduction, they exhibit genetic…

Q: 21. Which macromolecules always contain carbon, hydrogen, oxygen, nitrogen, and sulfur? A. nucleic…

A: Introduction:- Any exceedingly big molecule with a diameter ranging from roughly(105 to 103 mm) is…

Q: Chemical communication is one of the most widely used means of communication among insects. How do…

A: To give How Pheromones affect on insect behaviours Types of pheromones Example of insect

Q: Which of the following factors is the least important when the physician prescribes an antibiotic to…

A: As we know that antibiotics are low molecular-weight antimicrobial agents produced by secondary…

Q: 51. In a certain country in 2000, there were 325,000 live births and 1,750 infant deaths. What is…

A: The mortality rate, often known as the death rate, is a measurement of the total sum of fatalities…

Q: 1. Insulin..... a. Carries glucose into the muscle cell b. signals the muscle cell to take up…

A: 1. Insulin - b. signals the muscle cell to take up glucose. Explanation - The main actions that…

Q: what is the purpose of calcium ion in fertilization?

A: * Fertilisation is an generative fertilisation fusion of gametes gives rise to a new individual…

Q: Which statement is NOT a key recommendation according to the current Dietary Guideline? Select one:…

A: Dietary guidelines provide advice on what to eat and drink for a healthy lifestyle. These help to…

Q: A team of investigators is out on a boat on a lake on a marvelous,sunny summer day, and they are…

A: Introduction  Ocean have totally different ecosystem as there are different factors that affect the…

Q: Discuss different systems of biological classification briefly.

A: Introduction In this question we will discuss about the different systems of biological…

Q: What are ferns? Describe its salient features.

A: Introduction Ferns:- The ferns are also referred to as Polypodiophyta, The word “Pteridophytes”…

Q: How do nerves control every organ and function in the body?

A: Although nerves play an important part in the human body, they do not govern every tissue and…

Q: If we were performing experiments on campus, how would you test the functions of excretory system?…

A: The organs and systems that remove waste from the body. For example, the organ system that regulates…

Q: The most important piece of evidence missing from Darwin’s original hypothesis was:

A: There are some points about Darwinism : Provided evidence for scientific theory that all species…

Q: 2. In the guinea pig, a locus controlling coat color may be occupied by any of 4 alleles with the…

A: To Determine the genotypic and the phenotypic ratios of the offspring if the guinea pigs have coat…

Q: what are the fundamental steps in canning?

A: The history of canning begins when Napoleon promised money to devise a way of preserving food during…

Q: 1. A woman is colorblind. Construct a Punnett square and using versions of the letter “C” determine…

A: As per our company guidelines we are supposed to answer only first question or first 3 subparts of…

Q: Explain how the three forms of adult muscle have various potentials for regeneration after injury.

A: Cell organelles are the building blocks of a cell. They are useful for conducting various cell…

Q: Mention and describe the two types of bacterial resistance to antibiotics.

A: The emergence of resistance among the most essential bacterial pathogens is recognised as a main…

Q: 1 pts List the following events in order as they would occur inside a skeletal muscle fiber: 1)…

A: The signals of contraction of muscles are carried by the nerves at the neuromuscular junction…

Q: Premature-birth Risk Found Higher for Teens (reported in the Sacramento Bee, April 27, 1995, p. A7)…

A: Relative risk is defined as the comparative analysis of risks among two groups, namely the…

Q: what structure prevents food from entering the windpipe?

A: The trachea is often called the windpipe. It's a key part of our respiratory system. When we breathe…

Q: how much nuclear DNA in picograms is present in a skin cell during anaphase?

A: DNA is the genetic material present indide the nucleus of each of the cells in the eukaryotic body.…

Q: What are ferns? Describe its salient features.

A: Ferns can be found in a variety of habitats, including warm, moist tropical regions and dry, rocky…

Q: Identify the benefits and risks of Genetically Modified Organisms

A: Genetical Modified Organisms in Plants Genetical modified plants is nothing but modifying the DNA of…

Q: Which of the following genetic mechanism isn't used by bacteria in the transference of genetic…

A: *NOTE: Kindly repost for other question Dear Student as per the guidelines we are supposed to answer…

Q: 1. The is the side of the epithelial cell that faces the external environment or an internal…

A: According to guidelines we have to answer the first question only. so please kindly post the…

Q: How does the process of DNA replication generate mismatch mutations? What mechanisms are available…

A: DNA replication is the process in which dsDNA is copied to produce two identical DNA molecules.

Nutrition and diet

We are involved in several daily activities. These actions need a significant quantity of energy. The food we eat provides this energy. Food is necessary for development, repair, and other living activities since it supplies energy. All of these are part of the living practice known as nutrition. Nutrition is the study of nutrients in food, how the body uses them, and the relationship between diet, health, and disease. Nutritionists employ concepts from molecular biology, biochemistry, and genetics to understand how nutrients affect the human body. Nutrition also looks at how people can use their diet to reduce their risk of disease, as well as what happens when they ingest too much or too little of a nutrient and how allergies emerge.