DNA A G T A C C G G G C A A A C T G C A T T G T G mRNA U C A U G G C C C G U U U G A C G U A A C A C Use the "Genetic Code Chart" to determine the sequence of amino acids in your polypeptide chain. Remember to START translation at the start codon by adding a Methionine and STOP translating when you reach a stop codon.
Q: Order of Order of Order of Amino Acid bases bases in MRNA | (codon) bases Coded into in DNA in TRNA…
A: As we know DNA contains A T G C Bases and RNA Contains A U G C Bases. mRNA is complementary to DNA…
Q: Which of the following statements are true? O Each stop codon also codes for an amino acid O Each…
A: DNA contains both coding and non-coding region where introns are non-coding regions and exons are…
Q: Translate the following RNA sequence by using the genetic below. Start at the beginning of the…
A: Protein is made up of a chain of monomeric subunits called amino acids joined together by peptide…
Q: C4GUCAGUCAGUCO/ Use the codon chart to determine the following RNA strand in amino acids (Remember…
A: Genetic code The relationship between the sequence of amino acids in a polypeptide chain and…
Q: Use the codon chart to determine the following RNA strand in amino acids (Remember to write it the…
A: Each codon is made up of three nucleotides, each of which corresponds to a single amino acid. The…
Q: Translate the following RNA sequence by using the genetic below. Start at the beginning of the…
A: The proteins are the final end product of a gene that ultimately determine the characteristics of an…
Q: Below is a segment of RNA, transcribed from a DNA sequence. Provide an example of each kind of…
A: Any detectable, inheritable qualitative or quantitative change in genetic material of an organism…
Q: Original DNA Sequence: T A C A C C T T G G C G A C G A C T … mRNA Sequence: Amino Acid Sequence:
A: CENTRAL DOGMA- Replication is the process when DNA replicates itself means it will make copies of…
Q: A segment in the middle of an mRNA has the sequence 5¿- AGAGAACCGCGA-3¿. Using the codon table,…
A: With the help of translation process protein forms. The nucleotide sequence are translated into…
Q: Degeneracy of the genetic code denotes the existence of which of the following? A. codons that can…
A: Characteristic of genetic code: - The genetic code is a triplet (first suggested by Gamow in 1954).…
Q: Which codon codes for the C-terminal residue in the polypeptide structure shown below? H3N 'N' NH3 H
A: GENETIC CODE is the relation between the base sequence of a gene and the amino acid sequence of the…
Q: During planetary exploration a new life form is discovered which has a DNA genome containing 6…
A: Nucleus is the genetic centre of the cell. It contains hereditary and genetic information stored in…
Q: Use the genetic code to complete the following table. Assume m that reading is from left to right…
A: In DNA double helix Adenine (A) pairs with Thymine(T) and Guanine (G) pairs with Cytosine (C).…
Q: then translate the resulting mRNA using the gentic code table below. Choose the correct sequence of…
A: The flow of genetic information in cells from DNA to messenger RNA ( mRNA) to protein is identified…
Q: The amino acids listed above that are coded by the mRNA codon
A: Protein synthesis is a major process inside our body .Our body has complex system for protein…
Q: mRNA: TCCGATGCCACGGGTCATCTCGGACGTGTGAATCGA 3. Your mRNA will now be translated. Refer to the genetic…
A: Inside the nucleus of the cell , DNA act as a template for the manufacturing of single strand of…
Q: Second letter UUU Phenyl- UUC alarine UGU UGC Cysteine UAU UCU UCC UCA UCG UAC yrosine Serine UUA…
A: Mutation of amino acids change the primary structure of the protein which affects the protein…
Q: If given the following coding strand of DNA, what is the mRNA? What tRNA will be present? (hint -…
A: DNA is a hereditary molecule made up of two polynucleotide chains lies in the nuclues of all…
Q: DNA molecules consist of chemically linked sequences of the bases adenine, guanine, cytosine, and…
A: Codon is a base triplet that exists in DNA. DNA gets transcripted to mRNA which then translates to…
Q: Use the table below to help you answer the following question. THE CODON TABLE FIRST POSITION SECOND…
A: Ans- Tyrosine was replaced with cysteine.
Q: The following segment of DNA in a hypothetical model organism encodes a polypeptide containing SEVEN…
A: Francis Crick proposed central dogma. The RNA is formed from DNA with the help of enzyme RNA…
Q: Shown below is a DNA coding strand: 5' T-A-C-T-T-C-C-C-G-A-T-C-A-T-T 3' Using the genetic code…
A: The genes in DNA encode protein molecules, which serve as the cell's "workhorses," performing all…
Q: A small section of MRNA codons has the following sequence: UGU GGU CAA CCG Some Amino Acids 1.…
A: Translation or protein synthesis is the third major step of the central dogma of life. mRNA…
Q: DNA C T A T T G C A C C T G A G T C C A mRNA…
A:
Q: polypeptide peptide bond +amino acid tRNA codon anticodon UCA GCA CGU UGC GU ACG UCA ribosome MRNA
A: Translation is the process of formation of a sequence of amino acids using mRNA as a template. It…
Q: explain why a mutation in the dna nucleotide sequence that corresponds to the 3rd nitrogen base in…
A: A mutation is a change that occurs in our DNA sequence, either due to mistakes when the DNA is…
Q: Table 1. The Genetic Code: Codons and Their Amino Acids First Two Nucleotides of Codons Last…
A: B). UUA - LEUCINE C) GAG - GLUTAMATE D) UAUCUA- TRYOSINE, LEUCINE E) AUCUUG - ISOLEUCINE, LEUCINE…
Q: Second base of codon U A G UCU Phenylalanine UAU UUU UGU Cysteine U Tyrosine tyr y UUC phe F UCC UAC…
A: A) The Adenine (A) is present in the intron or non-coding part of the gene, transcription results in…
Q: Below is a diagram of charged tRNAs in the active site of the ribosome during translation of the…
A: Translation is the process of synthesis of protein. It takes place in the cytoplasm.
Q: A portion of an unknown enzyme has the amino acid sequence leucine – alanine – lysine – tyrosine.…
A:
Q: is the MINIMUM number of tRNA's needed to recognize all of the codons for glutamate (Glu)
A: Deoxyribonucleic Acid (DNA) is made up of four main bases, also known as nucleotides. These are -…
Q: True or false Both pentose nucleic acid and deoxypentose nucleic acid contain the same pyrimidines…
A: Disclaimer: Since you have posted a question with multiple sub-parts, we will solve first three…
Q: Refer to the codon diagram on. Which of the following is a codon that will terminate translation?*
A: A termination codon or a stop codon is a group of three amino acids that is present in the mRNA that…
Q: Which of the following statements regarding the genetic code is false? The genetic code is…
A: Genetic code is used for ways in which the four bases of DNA- - the A, C, G, and Ts- - are hung…
Q: All of the following are true about translation EXCEPT _____. as the ribosome moves from codon…
A: Answer :- All of the following are true about translation except - Ribosomal subunits and a…
Q: If the mRNA molecule from your answer to the previous question is going to be translated into a…
A: The gene is the portion of DNA that codes for a specific protein. First, the DNA is converted to…
Q: DNA gene TAC AGC TTT mRNA codon (No thymine in RNA!) tRNA anticodon (No thymine in…
A: According to Bartleby guidelines, the first three questions have been answered. Kindly post the…
Q: Jse the table below to help you answer the following questions. THE CODON TABLE FIRST POSITION…
A: Given: DNA: TAC-GCT-ATG-AGC PROTEIN: METHIONINE-ARGININE-TYROSINE-SERINE. MUTATION DNA:…
Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences…
A: Given DNA strand: 5' - CCTATGCAGTGGCCATATTCCAAAGCATAGC - 3'
Q: Define the following terms as they apply to the genetic code: a. Reading frame b. Overlapping code…
A: Note - We answer one question at a time. The set of rules through which information in the DNA or…
Q: If a TRNA anticodon was GUG, which amino acid would the tRNA carry? Below is a partial genetic code…
A: TRANSLATION It is the process of formation of a polypeptide chain by joining of various amino acids.…
Q: Use Table 1 to read the codons below. Find the name of the amino acid and write it in the space…
A: b) UUA: Leucine c) GAG: Glutamate d) UAU CUA: Tyrosine-Leucine e) AUC UUG: Isoleucine-Leucine
Q: What is the order of the polypeptide chain shown in the images provided? Starting at the…
A: Translation is the process of synthesizing proteins from RNA template through series of reactions on…
Q: Refer to the codon diagram on. Which of the following is a codon that will terminate translation? *…
A: The process of formation of a polypeptide sequence from an mRNA transcript is known as translation.…
Q: The images shown depict the initiation and elongation steps in protein translation. Arrange the…
A: The amount of mRNA which is define with the mechanism that is usually produced by a gene is limited,…
Q: You are studying two mRNA sequences. The nucleotides in the first sequence are in the correct order:…
A: As per the 1st sequence of bases given, the amino acids present would be- Gly-Arg-Cys After the…
Q: Analyze the following amino acid sequence and write down a potential mRNA sequence from which this…
A: The translation is a process by which ribosomes in the endoplasmic reticulum synthesize proteins…
Q: Use the first picture and codon table to answer the following questions.
A: The exons are the coding portions of the gene and introns are the non-coding portions, which need to…
Q: Below is a short segment of a DNA molecule. Transcribed the DNA codon into mRNA. Use your data sheet…
A: Transcription is the process by which RNA polymerase read out DNA template stand and synthesize…
Q: Use the genetic code table. Which amino acid is coded for by only one codon sequence? Second…
A: Ans is.. methionine
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
DNA A G T A C C G G G C A A A C T G C A T T G T G
mRNA U C A U G G C C C G U U U G A C G U A A C A C
Use the "Genetic Code Chart" to determine the sequence of amino acids in your polypeptide chain. Remember to START translation at the start codon by adding a Methionine and STOP translating when you reach a stop codon.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Use the codon chart to determine the following RNA strand in amino acids (Remember to write it the same way the strand is): ACA-AGG-UUA-UGA second letter C A UAU Tyr U UUU UCU UGU Phe Cys UUC UCC UAC UGC C Ser UAA stop | UGA stop| A UAG stop UGG Trp UUA UCA UUG Le UCG CUU CCU CAU CGU His CUC ССС CAC CGC Leu Pro Arg CUA ССА САА CGA Gln СCG CAG CGG CUG AGU AAU Asn AUU ACU Ser AGC S AGA Arg AAC AUC } lle A AUA АСC Thr AAA Lys АСА AUG Met ACG AAG AGG GUU GCU GAU GGU Asp GAC GGC Gly GGA GCC GUC Val Ala GAA GAG } GUA GCA Glu GGG GUG GCG Your answer first letter ACUCAGUCAGUCAG third letterUse the table below to help you answer the following questions. THE CODON TABLE FIRST POSITION SECOND POSITION THIRD POSITION UUU UCU UAU UGU Phenylalanine Tyrosine Cysteine UCC Serine UUC UAC UGC UA UCA UAA Stop UGA Stop Leucine UUG UCG UAG Stop UGG Tryptophan CU CCU CAU CGU Histidine CUC CAC CGC Leucine Proline Arginine CUA CA CAA CGA Glutamine CUG CCG CAG CGG AU ACU AAU AGU Asparagine Serine AUC Isoleucine ACC AAC AGC Threonine AUA ACA AAA AGA Lysine Arginine AUG Methionine Start ACG AAG AGG GUU GCU GAU GGU Aspartate GUC GCC GAC GGC Valine Alanine Glycine GUA GCA GAA GGA Glutamate GUG GCG GAG GGG Original DNA DNA TACGCTAT GAG C Protein Methionine-Arginine-Tyrosine-Serine Mutation #3 DNA TACGCTATCGAGC How would describe this mutation? (choose ALL that apply) Substitution Deletion Frameshift Silent InsertionTable 1. The Genetic Code: Codons and Their Amino Acids First Two Nucleotides of Codons Last Nucleotide of Codons The Amino Acids A UU phe phe leu leu Abbreviations Names UC gly glycine ser ser ser ser UA tyr tyr term ala alanine term val valine UG cys cys term trp ile isoleucine leu leucine CU leu leu leu leu ser serine CC pro pro pro pro threonine proline aspartate glutamate lysine arginine thr CA his his gin gin pro asp glu lys CG arg arg arg arg AU le ile ile met AC thr thr thr thr arg asparagine glutamine cysteine methlonine asn AA lys lys asn asn gin AG ser ser arg arg cys met GU val val val val trp phe tryptophan phenylalanine tyrosine histidine GC ala ala ala ala tyr his GA asp asp glu glu GG gly gly gly gly term termination 3. Use Table 1 to read the codons below. Find the name of the amino acid and write it in the space provided. If the letters code for more than one amino acid, separate the names by dashes. b. UUA: c. GAG: d. UAUCUA: e. AUCUUG: f. AAGAGUUCG: g. AAAUUUGGG: h.…
- If the sequence of amino acids encoded by a strand of DNA is serine-alanine-lysine-leucine, what is the order of bases in the sense strand of DNA? Use the codon chart below to help you: second letter A G UAU Tyr UGU UUU UCU Phe Сys UUC UCC UAC UGC Ser UAA stop |UGA stop | A UAG stop UGG Trp UUA UCA UUG Leu G UCG CUU CCU CAU CGU His CUC ССС САС CGC Leu Pro Arg CUA ССА САА CGA Gln CUG CCG CAG CGG AUU ACU AAU AGU Asn Ser AUC le A AUA AAC AAA AGC AGA Arg АСС Thr ACA AUG Met | ACG AAG Lys AGG GUU GCU GAU GGU Asp GUC Val GUA GAC S GAA Glu GCC GGC Gly GGA Ala GCA GUG J GCG GAG GGG) O 3' AGACGTTTCAAT 5' O 3' UGUGCAAAGUUA 5' О 5 TGTGCTTТCТТА 3' first letter UCAG UCAG PCAG third letterThe sequence of a polypeptide is determined by the order of codons that specify the amino acids in the polypeptide. How many different sequences of codons can specify the polypeptide sequence methionine-histidine-lysine? (Use the table to find the number of possibilities.) SECOND BASE UAU UACFTyrosine (Tyr) UAA -Stop codon UAG -Stop codon UUUL UGU Cysteine (Cys) UCU uc UCA FSerine (Ser) uca Uuc Phenylalanine (Phe) UUAL Leucine (Leu) CAU CAC CAA Glutamine (Gin) CAGF UGA -Stop codon uaa -Tryptophan (Trp) CGU сос CGA FArginine (Arg) CU CU Histidine (His) CuA FLeucine (Leu) Cua) Proline (Pro) CCA cca AAU Asparagine (Asn) AGU Serine (Ser) AGC AUU ACU ACC Threonine (Thr) AACF AAA AAGLysine (Lys) AUC Fisoleucine (lle) AUA Methionine (Met) AUG - Start codon ACA ACG AGA AGGFArginine (Arg) GU GACAspartic acid (Asp) GGA GAA Glutamic acid (Glu) Gaa) GcU -Valine (Val) G GUA GCA FAlanine (Ala) Glycine (Gly) 8. 1 4 THIRD BASE 2. FIRST BASEThe chart can be used to determine the amino acid that a specific codon encodes. Finl Second Letter Thind Letter U с A G phenylalanine serine tyrosine cysteine U phenylalanine serine U tyrosine cysteine с leucine serine stop stop A leucine serine slop tryptophan G leucine proline histidine arginine U leucine proline histidine arginine с leucine proline glutamine arginine A leucine proline glutamine arginine G isoleucine threonine asparagine serine U isoleucine threonine asparagine serine C isol cine threonine arginine A (start) lysine lysine threonine arginine G valine alanine aspartate glycine U valine alanine aspartate glycine C valine alanine glutamate olycine A valine alanine glutamate glycine G If a strand of DNA had the sequence GACTTC, then mutated to be GACATC, what sequence of amino acids would be formed? Aspartate and phenyalanine become apartate and isoleucine Leucine and lysine become leucine and tyrosine Aspartate and phenyalanine become aspartate and methionine Leucine…
- What polypeptides would be formed from the sequence UCAATGGGGUUUAUAGCG… (there are bases after the last G but we don’t know what they are so there may be some ambiguity for the last codon with regards to the amino acid possibilities) if the translation frame had UCA as the first codon: if the translation frame had CAA as the first codon: if the translation frame had AAT as the first codon:Glycosylation is a major type of protein post-translational modification. Identify the amino acid that is joined to each monosaccharide by a glycosidic bond. glycoprotein A glycoprotein B glycoprotein C HA HO Н CH₂OH HO OH Н H CH₂OH Н ОН HO HN-C-CH3 о c=0 NHI -NH-C - CH2C-H ОН Н нн ОН НН CH2OH Он OH HO Н NH 1 С=0 -CH2-C-н NH C=0 LO-CH2-C-H NH A В сSecond letter C A UUU Phenyl- UUC alanine UCU UCC UAU UAC UGU UGC Tyrosine Cysteine Serine UCA UCG UAA Stop codon UAG Stop codon UGA Stop codon UGG Tryptophan UUA A Leucine UUG CCU ССС CAU CAC CUU CGU CGC Histidine C CUC C CUA Leucine Proline Arginine CCA СCG CGA CGG A CAA CAG CUG Glutamine AGU AGC AUU AAU ААС ACU Asparagine Serine AUC Isoleucine A AUA ACC АСА Threonine AAA AGA Methionine; start codon ACG Lysine Arginine AUG AAG AGG U GUU GUC GUA GCU GCC GCA GAU Aspartic GAC acid GGU GGC GGA GGG Valine Alanine Glycine GAA Glutamic GAG acid GUG GCG G Given the codon UCA in the first exon of a gene, which change is most likely to result in a nonsense mutation? A transversion of A to U Change of nucleotide in the third position Change of nucleotide in the first position A transition of A to G Change of nucleotide in the second position First letter Third letter
- Use the table below to help you answer the following questions. THE CODON TABLE FIRST POSITION SECOND POSITION THIRD POSITION UUU UAU UGU Тугosine Cysteine UUC Phenylalanine UAC UC UGC UCA Serine UAA Stop UUA UGA Stop Leucine UUG UG UAG Stop UGG Tryptophan CUU CCU CAU CGU Histidine CUC Leucine CỦA C CÁC CC Arginine CGA Proline CA CAA Glutamine CUG CG CAG CGG AUU ACU AAU AGU Asparagine Serine AUC Isoleucine A AUA ACC AAC AGC Threonine ACA AAA AGA Lysine Arginine AUG Methionine Start ACG AAG AGG GUU GCU GAU GGU U Aspartate GUC GCC GAC GGC Valine Alanine Glycine GUA GCA GAA GGA Glutamate GUG GCG GAG GGG Original DNA DNA TACGCTAT GAGC Protein Methionine-Arginine-Tyrosine-Serine Mutation #1 DNA TACTCTATGAGC What effect did it have on the protein produced? (you will need to determine the protein to answer the question) O Guanine was replaced with a thymine There was no change in the protein produced (i.e. it's a silent mutation) O Arginine was replaced by Threonine O The amino acid was…Refer to the information on the genetic code. Use this information to determine how many amino acids are coded for by the mRNA sequence AUGCGCAGUCGGUAG. The genetic code Second letter of codon UAU UAC JUU Phenylalanine uCU UUC Phe) UUA Leucine (Leu) UUG Tyrosine (Tyr) GCysteine (Cys) UGC 1oStop codon |UGG Tryptophan (Trp) CGU CGC UcC Serine (Ser) UCA ucc CCU cC Proline (Pro) Stop codon UAG Stop codon CAU Histidine His) CU CUC CUA CUG Arginine (Arg) Leucine (Leu) cca CAA CCA CGA Glutamine (Gin) CAG AUU AUC AUA ACU Isoleucine (le) AAU AAC AGU AGC Asparagine (Asn) Serine (Ser) ACC Threonine (Thr) ACA Methicnine ACC start codon GCU Lysine (Lys) AGA Arginine (Arg) ARC AGS GAU Aspartic acid (Asp)G0 GAC GUU GUC Valine (Val) GCC Alanine (Ab) GG Glycine (Gly GUA GUG GCA GCG GA Glutamic acid (Glu) GA GGG GAG 4 15 First letter of codon Third letter of codonGiven the following codons and their corresponding amino acids: UUU-Phenylalanine GAA- Glutamate CAA- Glutamine AAU- Asparagine AAC- Asn AAA- Lysine UCU- Serine GGA-Glycine ACC-Threonine AUG- Met/ START codon CCU- Proline GUU- Valine UAU-Tyrosine UAA- STOP AGG- Arginine AUU- Isoleucine CAU- Histidine GCU- Alanine UGU-Cysteir GAU-Asparti CUA-Leucine UGG-Tryptol CGU-Arginin Box 1: Show the mRNA sequence which codes for the short peptide, lys-ala-phe- leu. Include what should come before and after this short message. Don't leave any spaces between the letters. Box 2: Show the tRNA anticodon sequence that would line up with the mRNA strand from Box 1. Don't leave any spaces between the letters. Box 3 & 4: Show the DNA base sequence that would be found in the DNA double helix which carries the gene for this peptide. Give the coding strand sequence in Box 3 and template strand sequence in Box 4. Don't leave any spaces between the letters. Box 5: What if there was a frameshift at leucine…