Michelle has a clone of the DNA of a newly discovered virus. She wants to identify which specific cells of an organ are infected by the virus. What method would be the most useful to answer this question? O restriction fragment analysis O microinjection of the gene fragment O Sanger sequencing of the clone O FISH (fluorescent in situ hybridization) O real time PCR

Michelle has a clone of the DNA of a newly discovered virus. She wants to identify which specific cells of an organ are infected by the virus. What method would be the most useful to answer this question? O restriction fragment analysis O microinjection of the gene fragment O Sanger sequencing of the clone O FISH (fluorescent in situ hybridization) O real time PCR

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter18: Dna Technologies: Making And Using Genetically Altered Organisms, And Other Applications

Section: Chapter Questions

Problem 9TYK

See similar textbooks

Similar questions

QUESTION 8 refers to how closely individual measurements agree with each other and reflects a repeatability in those measurements. O Precision O Accuracy O Measurement Sensitivity QUESTION 9 The presence of the Lac Z gene in a plasmid to screen for blue and white bacterial colonies on an LB plate makes Lac Za O Reporter gene Antibiotic resistance gene O Multiple cloning site O Origin of replication
QUESTION 7 Primers are needed to start a PCR reaction True O False QUESTION 8 Restriction enzymes specifically recognize and cut short sequences of DNA called introns. O exons. O sticky ends. restriction sites. QUESTION 9 The DNA profiles used as evidence in a murder trial look something like supermarket bar codes. The pattern of bars in a DNA profile shows O the order of genes along particular chromosomes O the order of bases in a particular gene O the presence of differently-sized fragments of DNA O the presence of dominant or recessive alleles for particular traits O the number of chromosomes and whether any are damaged
QUESTION 9 which one of these is not required for performing PCR OA template O B. DNA bases OC Reverse transcriptase O D. Primers O D. DNa polymerase
[ Choose [Choose ) cloning vector polymerase chain reaction (PCR) restriction enzyme recombinant DNA molecule gel electrophoresis
Question 1. Restriction endonucleases can be isolated from a number of bacteria. In bacteria restriction endonucleases. a-restrict chromosomal DNA that is heavily mutated b-restrict chromosomal DNA with significant regions that have been Deleted. c-restrict the DNA of invading bacteriophages. d- all of the above Question 2. In a PCR reaction the step in which DNA polymerase replicates the DNA is referred to as a- denaturation b- annealing C- extension d- initiation
OO HUAWEI Nova 2 Plus DUAL CAMERA estion To study the function of any gene of interest you would perform the loss and gain of function approaches by either deleting or re-expressing the gene of interest, which of the following can be used to determine and quantify the activity of the gene? red Oa. Microscopy d out of O b. Western blotting O C. PCR/OLA on O d. Gene knockdown O e. DNA hybridization stion Which one of the following is NOT correct regarding Bacterial Biosensors? O a. produced by all Pseudomonas species ed O b. Encoded by LacZ gene out of O c. Encoded by Lux genes O d. Chemical compounds used for the quantitative assessment of water pollution O e. In the presence of pollutants the bioluminescent decreases. stion CD4-Pseudomonas Exotoxin Fusion Protein is another biotechnology strategy for HIV therapeutic setting. This construct will target and kill: Select one: d O a. Any lymphocyte put of O b. HIV (virus only) O C. Non infected TH O d. Infected TH cells O e. Infected TH…
O e. Gene amplification CLEAR MY CHOICE To study the function of any gene of interest you would perform the loss and gain of function approaches by either deleting or re-expressing the gene of interest, which of the following can be used to determine and quantify the activity of the gene? Oa. Western blotting O b. Gene knockdown O. PCR/OLA O d. Microscopy O e. DNA hybridization Paternity testing can be detected most precisely by using technique
Question 23 Match the following events in the recombinant DNA and cloning process Prompts gene of interest and the DNA vector are separately cleaved to generate ends that can join DNA is introduced to host cells vector DNA and the gene of interest are joined together only the clones with the recombinant DNA are used for downstream applications Submitted Answers Choose a match transformation marker-assisted selection directional cloning ligation by a ligase action restriction enzyme cleavage
During proofreading, which of the following enzymes reads the DNA? primase topoisomerase DNA pol helicase
FIGURE 2 shows the only suitable DNA restriction site in a plasmid DNA vector that can be cleaved. 5'.GTAATCCGGATCCGAAATCCCCCGG... 3' 3.CATTAGGCCTAGGCTTTAGGGGGCCC... 5 FIGURE 2 Identify the most suitable enzymeto be used as a restriction enzyme forthis purpose. O Ligase O Smal O EcoRI О ЕсoRV
A Moving to the next question prevents changes to this answer. Question 1 Which step is NOT included in the technique called Southern blotting? O a. visualization by autoradiography or fluorescence imaging Ob. exposure to a 32p-labeled DNA probe Oc amplification of the restriction fragment-probe duplex d. hybridization of the probe with a restriction fragment having a complementary sequence Oe transfer of the mixture of restriction fragments into a membrane composed of nitrocellulose &Moving to the next question prevents changes to this answer. MacBook Pro esc Q Search Secure Search %23 2 & LO % 4
Restriction Enzymes Handout plasmid Restriction Enzymes Bam HI Eco RI Hpa I Hind III Nde I Please solve this question in less than 15 minutes for genetics engineering Sal I Plasmid Handout DNA Sequence (both strands are represented) GIGATCC CCTAG G U G|AATTC CTTAA G GTT | AAC CAAjTTG A|AGCTT TTCGA | A CATATG GTATAC G|TCGAC CAGCT | G agtgacata tga ttcgag c cggta a c tca ctgtat a ст aagctcgagccattg cggggat cctctag agtcgacctgcagg c gcccctaggagatctcagctgga cgtc cg tagca ag c tggcgt at atggta cata at cgttcga accgcattagtaccat gta t gggatceptet ct ccagtaggtaggc cgtcg ccct agga aga g g t catccat cc ggcag c Antibioty Resistance gene gc taggetta a actgggatccat gcc origin o tplgm cg at cc a at ttgaccctaggta cgplasmid replication What is the role of the plasmid ? Explain the experimental details of the transformation. How can the success of transformation be observed ?