Q: Outline the specific differences in the pelvis and the femur that are associated with bipedalism in…
A: Introduction :- When an organism uses its two back limbs or legs to travel on land, this is known as…
Q: The molecule shown below is a substrate for trypsin. Draw the reaction products for the lysis of…
A: Introduction An enzyme called trypsin, located in the early part of the small intestine, initiates…
Q: 2. In a population with 1000 individuals, we observed the following genotype frequencies: -A T- C-…
A: In SNP I p2=AA=298, so p=17.26,q2=GG= 213, so q=14.59 and 2pq=2x17.26x14.59= 503.64. In SNP II…
Q: Why should changing the genome of human embryos ( human germline gene editing) not be allowed?…
A: CRISPR is a acronym for clustered regularly interspaced short palindromic repeats. It is a gene…
Q: A is a dominant gene for normal pigment, and a is its recessive allele for albinism (and pink eyes).…
A: Alleles are the alternative forms of a genes that are located on the same locus of homologous…
Q: Why does Northern blotting not require the use of restriction enzymes?
A: Restriction enzyme naturally cleaves DNA because it's have double stranded sequence of neucleiotides…
Q: There is a type of toxin found in the liver of the puffer fish that prevents the opening of…
A: Introduction The neurotoxin tetrodotoxin (TTX) is highly toxic. Its name is derived from the group…
Q: Name (Last, First): DNA An RNA Polymerase attaches to the DNA and transcribes the DNA to mRNA…
A: Introduction Gene expression is the process through which a gene's information is used to create a…
Q: The essay should consider the following: A description of the key features of stem cells when…
A: Tissue engineering It refers to the branch of biomedical engineering that replaces, maintains, or…
Q: Question 24 Proteins can move, twist and even walk, how? By hydrolysing a phosphate from ATP causing…
A: Introduction :- Large, intricate molecules known as proteins play a variety of vital functions in…
Q: 1. Carbon dioxide +Water+ Energy → Sugar + Oxygen 2. Sugar + Oxygen → Water + Carbon Dioxide +…
A: Cellular Respiration: The process of cellular respiration involves the oxidation of biological…
Q: Glucose Oxidase – Triglyceride – Total cholesterol - HIgh density lipid – 5. What are some…
A: 1. Glucose oxidase test- used for the determination of free glucose in body fluids. 2. Triglycerides…
Q: Consider a diploid cell that has 2n = 4 chromosomes: one pair of metacentric chromosomes and one…
A: Introduction :- The major feature of metacentric chromosome is that the central centromere divides…
Q: Why are individuals with an extra chromosome 21, that causes Down syndrome, more numerous than…
A: Extra Copy of chromosome cause different effects depend upon chromosome number . Some of the extra…
Q: Crossing over is an event occurring during metaphase II. True False
A: Crossing over is a cellular process that happens during meiosis a special type of cell division that…
Q: If a B cell receptor does not pass selection, is it better to be self-reactive against a…
A: In the primary lymphoid organs, such as lymph nodes and spleen, the selection is positive and…
Q: An activated sludge system operates at a flow rate (Q) of 400 m³/day (and an HRT of 0.129 day) with…
A: BOD (Biochemical Oxygen Demand) is an analytical method for figuring out the quantity of dissolved…
Q: 11 5 Humeral circumflex 3 Ulnar collateral A B C D 目
A: Introduction :- An artery in the arm is called the anterior humeral circumflex artery (also known as…
Q: True or False: (T/F) Physical forces acting on the thorax and wing hinge during flight are detected…
A: Insects have flight muscles attached directly to their wings. Flight muscles move the wings…
Q: Within a school of fish, each distance from its neighbors as they swim. When viewed from farther…
A: School of fish In biology, when a group of fish stays together and is swimming in a similar…
Q: Selection confers a reproductive advantage to individuals based on their adaptations, and therefore…
A: When reproduction takes place, the two types of gametes are coming together and form a zygote which…
Q: You eat a bran muffin topped with brown sugar for breakfast. Summarize the process of carbohydrate…
A: The gastrointestinal tract and other digestive organs make up the human digestive system. Food is…
Q: You have been put in charge of managing a population of the endangered pink fairy armadillo. The…
A: We know that Nt = No*2ñ Nt is population after time t No is initial population n is time taken…
Q: Sexual reproduction involves crossing-over to mix up genes. Is this a good thing or a bad thing? In…
A: Sexual reproduction involve fusion of male and female gamete containing "n" number of chromosomes to…
Q: If 400 mL of a 20% w/v solution were diluted to 2 L, what would be the final percentage strength?
A: Dilution is the procedure of lowering a solute's concentration in a solution. It generally only…
Q: Dizygotic twins are no more or less genetically similar than are other pairs of ________________.
A: Twins are named so because some of their completely identical features but there are certain…
Q: What are the objectives of these in vitro fertilization treatments? Please give examples
A: In vitro fertilization means that if some one couple have any problem not getting the pregnant…
Q: What are the precautions that should be observed in creatinine measurement?
A: A creatinine blood check measures the extent of creatinine withinside the blood. Creatinine is a…
Q: Complete Table I to summarize the function of organelles found in eukaryotic cells. Table 1 The…
A: In the question, it is asked to summarize the function of organelles in the eukaryotic cell.…
Q: What could be the function of the cordlike structure of the tendons? What is a function of…
A: The human forearm and the chicken wing are both limbs, yet they are not quite the same. Both the…
Q: Both the isolation buffer and assay buffer that was used in isolation of mitochondria contained 0.3M…
A: The purpose of using mannitol at this concentration in isolation buffer and assay buffer to…
Q: why are the steps in gram staining are so carefully standardized?
A: Gram staining is very useful process that differentiate bacteria on the basis of their cell wall…
Q: Describe how change, large and small, has an effect on the ecosystem with examples( for large…
A: Ecosystem It is a land where living and non living organisms interact with each others.
Q: he space below, sketch and label freshly collected specimens of a fema e cone, a male pinecone, and…
A: Pinus is an evergreen perennial, cold xerophytic tree. They range from medium size to tall size. The…
Q: Why are fish gills the most efficient of all respiratory organs?
A: Introduction The respiratory system, also known as the respiratory apparatus or ventilatory system,…
Q: Explain the reason for fact that the distinct serotypes are not different species instead when…
A: When you look at a living thing's morphological, anatomical, molecular, genetic, biochemical,…
Q: hat is chromosome disjunction and the effects of non-disjunction?
A: There are 46 chromosomes in a human cell and these are arranged in pairs so it can be set there are…
Q: While characterizing a mutation in a gene of interest, you discover that the mutation involves an…
A:
Q: Histone tails can be modified to change the shape and "tightness" of the nucleosomes. Acetylated…
A: Histone acetylation is the process of transfer acetyl group(functional group) to particular histone…
Q: our raw sequencing data, from two reactions, are given: 5'-ACCGTCGGTTACGCTTAGA-3'…
A: A) One Sequence Read as per data: GTTACGCTTAGA B) One Sequence Contig: ACCGTCGGTTACGCTTAGATAACAAG
Q: 2) how do our nephrons deal with Coke. you must mention each part of the nephron any filtration,…
A: The kidneys are a pair of bean-shaped organs on either side of our spine, below our ribs and behind…
Q: Briefly explain how multi factorial variables in the environment act concurrently
A: A set of observations, each described by several different sets of variables, is subjected to…
Q: Of what value is Gram staining?
A: Gram staining is a method frequently used to distinguish between two sizable groups of bacteria…
Q: P Q Figure 2 DOP R T P In which part of the leaf does most photosynthesis take place? Tick one box.…
A: Introduction :- Any of the main appendages of a vascular plant stem that are adapted for…
Q: Describe the different types of membrane transport. Which require energy, and which are passive
A: Introduction Cells can move things into or out of the cell via a variety of cellular transport…
Q: CO₂ + H₂O reactants Glucose produced by autotrophs Energy involved Maximum ATP production…
A: Autotrophs are organisms which are capable of carbohydrate synthesis by fixing atmospheric carbon…
Q: A second hit might occur through epigenetic alterations. In the promoter of RB1, there is a CpG…
A: Genes are similar to the operating system, blueprints, and programs, all packaged into one for our…
Q: Explain the Methods and standards for disposal of biomedical waste
A: Any garbage that contains infectious (or possibly contagious) components is referred to as…
Q: what is osmosis
A: Introduction: The cytoplasm of the cell and the extracellular spaces are separated by the plasma…
Q: What particular pathways or enzymes appear distinct for sulfate reducing bacteria in order to…
A: INTRODUCTION : Sulfate reducing bacteria - It is a type of bacteria which can reduce sulfate.They…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Question 6 True or False. Nonhomologous endjoining usually alters the DNA by deletions or insertions. True FalseQuestion: This is a normal 3 point test cross, except that instead of regular phenotypes, you are looking at DNA markers on a gel. One parent, according to the gel, is heterozygous at each marker. The other parent is homozygous for each marker. (Again, this means it is a test cross: AaEeHh x AAEEHH --but don't be confused by that, because these are not "dominant" and "recessive" per se; the phenotype is just a band on a gel). For each offspring, figure out its genotype (homozygous or heterozygous for each gene. Then, figure that one parent made only AEH gametes, so you can cross that out if it helps.) Then treat it pretty much the same as a 3 point test cross.Question- 1. In onions, male sterility is due to the interaction of a chromosomal allele pair hh and “sterile” (S) cytoplasm. All other combinations (i.e. HH/Hh and “sterile” cytoplasm, HH/Hh or hh “fertile” (F) cytoplasm) result in male-fertile plants. The male-sterile trait is incorporated into inbred lines to produce hybrid F1 seed on a commercial scale.a) How would you perpetuate the male-sterile line? Show the cross.b) Briefly outline the method of producing hybrid seed (heterozygote) for the commercial crop. Show the cross.c) Does it matter whether the cytoplasm is fertile or sterile in the male-fertile inbred? Explain.
- The two forms of recombination are general and _____________.Question 2. You have a wild-type strain of E. coli with the genotype A B C D EF You introduce an F+ plasmid into your wild-type strain and isolated a few Hfr derivative strains that you call Hfr1, Hfr2, and Hfr3. You are studying several new genes in E. coli with interesting phenotypes. You obtain a multiply mutant strain with chromosomal genotype: a b c d e f a) You mate each Hfr strain to your multiply-mutant strain in a separate experiment. At various times you interrupt the matings and plate the bacteria under conditions in which only the recipient strain can grow. You obtain the following earliest-time-of-entry data, in minutes: Gene Hfr1 Hfr2 Hfr3 A B C D E F 11 13 7 I 26 16 11 9 5 31 15 27 31 11 Draw a map of these genes that is consistent with the data, including all the genes and Hfr origins, the distances between them (in minutes), and the direction of transfer of each Hfr.b) Among the progeny from the Hfr3 mating above, you find one that has the genotype: Abc de F Draw out the gene transfer and crossover(s) that produced this outcome: c) Among the progeny from the Hfr3 mating above, you find one that has the genotype: A B c d e f Draw out the gene transfer and crossover(s) that produced this outcome:
- question- Color blindness is inherited as a sex-linked recessive disease. A normal male marries a female who is heterozygous for the trait. What percentage of their sons will exhibit color blindness?| Choose J [Choose] repetitive DNA transposable elements transposon retrotransposon pseudogenesO e. Penetrance QUESTION 10 Sickle-cell anemia is a human disorder caused by a recessive allele (HbS) for the hemoglobin gene found on chromosome #11. The normal allele (HbA) is dominant. Mary has sickle-cell anemia, and she marries Steve, who does not have the disease. Mary and Steve have one kid Rosa, who has sickle-cell anemia. What is Steve's genotype? Oa. HbS Ob. HbSHbS O c. HbAHbS O d. HbAHbA Oe. Cannot be determined ck Save and Submit to save and submit. Click Save All Answers to save all answers. 7 20 # 3 $ 4 % 5 MacBook Air
- Restriction mapping of the delta chromosome I need help with question two pleaseQuestion 23 Match the following events in the recombinant DNA and cloning process Prompts gene of interest and the DNA vector are separately cleaved to generate ends that can join DNA is introduced to host cells vector DNA and the gene of interest are joined together only the clones with the recombinant DNA are used for downstream applications Submitted Answers Choose a match transformation marker-assisted selection directional cloning ligation by a ligase action restriction enzyme cleavagehelp me