Which of the following stretches of RNA is most likely to form a hairpin with 4 bases making up the turn? OUUGCGCAUAACG GCUAUUCCGCUA CACGAUUCGCAC OGCUCUAAGGAGC
Q: What changes would you see in plasma (blood) acidity?
A: pH is the power of hydrogen ions. It is defined as the negative logarithm of hydrogen ion…
Q: Suppose a researcher previously cloned gene Y into M13 bacteriophage vector. Gene Y encodes a…
A: In order to solve this problem, first we need to find the amino acid sequence of the wild (original)…
Q: An enzyme with concentration of 3.0 uM is added to a flask containing 125 uM of substrate. You know…
A: The observed velocity (Vo) in enzyme kinetics denotes the initial rate of an enzyme-catalyzed…
Q: 2. Mitochondria isolated from bovine cardiac muscle, when subjected to sonication, form closed mem-…
A: The electrons released as NADH is oxidized, is carried to O2 via series of protein and non-protein…
Q: The transport would also be characterized as Aspartic acid uniform diffusion active facilitated…
A: The cell/ plasma membrane is the external protective barrier of the cell allowing movement of only…
Q: fertilizers
A: In various regions with distinct geographic characteristics, fertilizers containing zinc have been…
Q: how do telomeres protect against replicative shortening
A: Telomeres occur as repetitive regions found towards the end of a chromosome. Telomeres occur in a…
Q: What sugar is formed upon hydrolysis of starch and cellulose?
A: The question is asking about the type of sugar that is formed when starch and cellulose undergo…
Q: increase in AMP Increases glycolytic activity glucagon secretion feeding insulin secretion increase…
A: A metabolic process called glucose synthesis allows the body to produce glucose from…
Q: Why mutation would have a greater effect on the stability of a protein. a. Threonine to Valine b.…
A: A protein's propensity to preserve its initial, useful structure under a variety of circumstances is…
Q: The sigmoidal, cooperative binding curve commonly observed for hemoglobin is a result of: a)…
A: Since you have posted a question with multiple sub parts, we will provide the solution only to the…
Q: Name the monosaccharides in the images by placing the appropriate terms. CH₂OH OH OH ОН OH…
A: Carbohydrates are of various types. Based on the number of carbohydrate molecules, it is of 3 types,…
Q: The Michaelis-Menten equation is often used to describe the kinetic characteristics of an…
A: Vmax is defined as the maximum reaction velocity at which all enzymes become saturated with…
Q: Choose Two. The Ramachandran plot indicates: B Ca E ||||||| C1 H H A Combined preference for a about…
A: Amino acids are the building blocks of protein. There are 20 standard naturally occuring amino acids…
Q: The concept of determining which reactant is limiting and which is in excess is akin to determining…
A: In a chemical reaction, the chemical species react with each other to yield the product(s).These…
Q: Which of the following will saturate as solute concentration increases? a. Transport of sucrose…
A: Saturation kinetics describes the situation in which an enzyme reaction achieves its maximum…
Q: If the gene for myoglobin is "knocked out" in mice (so that the mice can no longer produce…
A: If the gene for myoglobin is knocked out in mice, causing them to be unable to produce myoglobin,…
Q: est tube Ascorbic acid stock (20 μg/mL) Citrate buffer Final Concentrations 1 0 μL 1000 μL…
A: In linear regression analysis, we examine whether one variable (called independent variable) can be…
Q: Discuss the major challenges when using microarray techniques to study differential gene expression.…
A: Microarray is a powerful laboratory technique used in genomics and molecular biology to…
Q: The isoelectric point of eIF4a is 5.02. Students are given a sample of cell lysate containing eIF4A…
A: Ion Exchange Chromatography (IEC) is a chromatography technique whose ability to separate analytes…
Q: All of the following statements about glucose are true except: Glucose is metabolized in the…
A: Glucose is a simple sugar (monosaccharide) that serves as a primary source of energy for living…
Q: Explain the role of transistors in microchip functionality
A: Microchips are tiny electronic devices containing a variety of integrated circuits. They are…
Q: What is the length (in nm) of an alpha-helix containing 15 amino acid residues?
A: Proteins frequently contain an alpha-helix as a secondary structure. The polypeptide chain of the…
Q: Proto-oncogenes are genes that have the potential to become oncogenes through either mutation or an…
A: Genes are the segments of DNA that code for proteins. These are passed from parents to offspring. A…
Q: What are the differences in atp formation in glycolysis vs oxidative met
A: ATP (adenosine triphosphate) is a critical molecule that stores and releases energy for cellular…
Q: yur as marking consists protein mat calowing Wi/ a 125 KD heteromer c de are of each subunt masses:…
A: The structure of the 125 kDa heterotrimeric protein given in question is depicted below.It is…
Q: 3. Fates of pyruvate. Pyruvate has several metabolic fates (some of which you'll learn later) but in…
A: Pyruvate is an important product of glycolysis. It can also be defined as an important junction…
Q: Finish the sentence alpha helical secondary structures in proteins Are connected by beta- turns Are…
A: Secondary structure is the ordered arrangement or conformation of amino acids in localized regions…
Q: The fungus Aspergillus giganteus degrades wood using the ribonuclease a-Sarcin. Of the molecules…
A: The ribonuclease α-Sarcin is used by the fungus Aspergillus giganteus to decompose wood. By…
Q: Draw the condensed structural formula of a gycerophospholipid trat contains two stearic acids and a…
A: Definition of condensed structure - The system for writing organic compounds in a single line is…
Q: Many resistance mechanisms are encoded on plasmids. These mechanisms are of great clinical…
A: BLAST is a bioinformatics tool that enables us to identify a gene if we know its DNA sequence or the…
Q: Why are several glycine residues found within the selectivity filter of K+ channels? a. Glycine…
A: The selectivity filter of potassium channels is the structural element directly responsible for the…
Q: mtDNA depletion syndrome 13 is a rare genetic disorder, in which individuals have fewer mitochondria…
A: When oxygen saturation in myocytes is lower than normal, myocytes could have impaired oxidative…
Q: A membrane simulator is shown below. Watch the video clip in order to answer the question. Diffusion…
A: Diffusion is very important process of nature where substances present in excess amount will move…
Q: The protein catalase catalyzes the reaction described by 2H₂O₂(aq) → 2H₂O)+O₂(g) and has a…
A: Km (Michaelis–Menten constant) = The substrate concentration at which the reaction velocity is half…
Q: What do most amino acids have in common with most monosaccharides? O Both contain ionizable groups…
A: Amino acids are the building blocks of proteins. There are 20 major proteogenic amino acids that…
Q: Which of the terms explain the relationship between the two compounds? CH₂OH ОН OH anomers epimers…
A:
Q: The sugar molecule shown below is the cyclic form of a/an carbon is in the position. HO-CH2 O H H OH…
A: In the carbohydrate chemistry, the diastereomers differing only at the hemiacetal or acetal carbon…
Q: Identify the parts of the G protein shown in the image. GB C Ga O GDP Answer Bank B subunit y…
A: G-protein is a GTP binding protein that is found closely associated with the receptor called the…
Q: Which one of these molecules would not be in a membrane? HC-0 НО HC-0 HC-0 image A D Galactose is a…
A: The most prevalent lipid molecules found in plasma membranes, commonly referred to as cell…
Q: The graph shows the oxygen-binding curves for myoglobin and hemoglobin. Label the graph and answer…
A: Fractional Saturation (θ) is the fraction of protein molecules saturated with ligands. (since it is…
Q: Consider the structure of calmodulin. Identify the correct statements about calmodulin. Calmodulin…
A: Calmodulin is a Ca2+ binding protein. It associates with many other proteins and thereby regulates…
Q: Assume a fragment of two-stranded antiparallel β-structure is 3.3 nm long. What is the approximate…
A: Deoxyribonucleic acid also known as DNA, is a molecule that houses the genetic instructions required…
Q: epinephrine and noradrenaline related?
A: Epinephrine and Noradrenaline:Epinephrine is also known as Adrenaline.Noradrenaline is also known…
Q: How many ATP, NADH, and FADH are formed in the krebs cycle?
A: Cellular respiration can be defined simply as a series of metabolic processes that take place within…
Q: Which of the following statements describes one reason that plant oils are generally healthier for…
A: Plant oils are liquid fats extracted from various plant sources, such as seeds, nuts, and fruits.…
Q: ANSWER THE FOLLOWING PROBLEM AND EXPLAIN YOUR ANSWER FOR BETTER UNDERSTANDING. 7.) Which Two Amino…
A: There are four classes of biological macromolecules: they are proteins, nucleic acids, lipids and…
Q: For the same drug, what amino acids of an active site of an enzyme would interact with one of the…
A: As we know that, hydrogen atom is electropositive atom, hence it will bond to the electronegative…
Q: Why might the compound below be a potent transition state analog inhibitor for isocitrate…
A: Transition states are short-lived species that arise as a substrate is being converted to a product…
Q: Choose the TRUE statement. A phospholipid micelle (not a liposome) can be characterized as Forming…
A: Phospholipids are important components of cell membranes and can form various structures in aqueous…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- If the sequence of amino acids encoded by a strand of DNA is serine-alanine-lysine-leucine, what is the order of bases in the sense strand of DNA? Use the codon chart below to help you: second letter A G UAU Tyr UGU UUU UCU Phe Сys UUC UCC UAC UGC Ser UAA stop |UGA stop | A UAG stop UGG Trp UUA UCA UUG Leu G UCG CUU CCU CAU CGU His CUC ССС САС CGC Leu Pro Arg CUA ССА САА CGA Gln CUG CCG CAG CGG AUU ACU AAU AGU Asn Ser AUC le A AUA AAC AAA AGC AGA Arg АСС Thr ACA AUG Met | ACG AAG Lys AGG GUU GCU GAU GGU Asp GUC Val GUA GAC S GAA Glu GCC GGC Gly GGA Ala GCA GUG J GCG GAG GGG) O 3' AGACGTTTCAAT 5' O 3' UGUGCAAAGUUA 5' О 5 TGTGCTTТCТТА 3' first letter UCAG UCAG PCAG third letterUse the codon chart to determine the following RNA strand in amino acids (Remember to write it the same way the strand is): ACA-AGG-UUA-UGA second letter C A UAU Tyr U UUU UCU UGU Phe Cys UUC UCC UAC UGC C Ser UAA stop | UGA stop| A UAG stop UGG Trp UUA UCA UUG Le UCG CUU CCU CAU CGU His CUC ССС CAC CGC Leu Pro Arg CUA ССА САА CGA Gln СCG CAG CGG CUG AGU AAU Asn AUU ACU Ser AGC S AGA Arg AAC AUC } lle A AUA АСC Thr AAA Lys АСА AUG Met ACG AAG AGG GUU GCU GAU GGU Asp GAC GGC Gly GGA GCC GUC Val Ala GAA GAG } GUA GCA Glu GGG GUG GCG Your answer first letter ACUCAGUCAGUCAG third letterFor the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG G
- A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)The following segment of DNA codes a protein. The uppercase letters represent Exons, the lowercase letters introns. Draw the pre- mRNA, the mature mRNA and translate the codons using the genetic code to form the protein. Identify the 5’UTR and 3UTR 5’- AGGAAATGAAATGCCAgaattgccggatgacGGTCAGCaatcgaGCACATTTGTGATTTACCGT-3’Part of a sequence of DNA from a person without this genetic disease is: TAG TAA AAA CCA CCC AGG Part of a sequence of DNA from a person with a genetic disease is: TAG TAA CCA CCC AGG The possible codons for some amino acids are shown in the table. Amino acid Codons glycine GGU GGC GGA GGG isoleucine AUU AUC phenylalanine UUU UUC serine UCU UCC UCA UCG Which amino acid is missing from a person with this genetic disease? serine glycine O phenylalanine isoleucine
- Please by using the first base of each as the first triplet in a condo, how do I translate two almost identical RNA strand into sequences? You will notice that the second strand has a point deletion (the u in bold) with respect to the first strand – comment on how this has affected the resulting peptide chain. aguuguuaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc aguuguaucgaaaacugcgaguaaauauccugagggcgcgaagcaaccWhich of these single strand RNA sequences could form a hairpin secondary structure? 5' AAAAAAAAAAAAAAAAAAA 3' 5' ACACACACACACACACAC 3' 5' CCCGGGGUUUUCCCCGGG 3' 5' UUUUUUUUUCCCCCCCCC 3' 5’ UUUGGGUUUGGGUUUGGG 3’Which of the following RNA sequences is an inverted repeat and can form a stem-loop structure? What is the correct option from the choices below? GGUAGGCAUUACGGAUGG GGUAGGCAUUAGCCUACC GAGAGAGAUUAGAGAGAG GGGGGGGAUUAGGGGGGG GAGAGUGUAAGUGUGAGA
- The DNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using this sequence, write the sequence of the polypeptide that results from this gene. Be sure to appropriately label the ends of the molecule. 5'-ATGCACGGCGACTAG-3' Second letter A UAU Tyr UAC First letter U A G U UUU1 UUC UUA LOU Leu CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu AUU AUC lle AUA AUG Met Val C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala CAU His CAC CAA CAG Gin AAU Asn AAC AAA 1 Lys AAG LYS G {}a UAA Stop UGA Stop A UAG Stop UGG Trp GAU 1 GAC Asp GAA GIU Glu GAGJ UGU UGC CGU CGC CGA CGG AGU AGC AGA AGG Cys GGU GGC GGA GGG Arg Ser Arg DOA DOA DOA DUTO Third letter GlyPlace sequences a, b and c into the correct order based on start and stop codons. Sequence ATCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGTSequence B TCAGACGTTTTTGCCCCGTAACAACTTGTTACAACATGGTCATAAACGTCAGAGATGGTC AATCTCTTAATGACTSequence CTACAAACATGTAAACACACCCTCAGTGGACCAACTCCGCAACATAAACCAAACACCGCTC GCGCCGAAAAAGATATGGTranslate the following mRNA nucleotide sequence into an amino acid sequence, starting at the first base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’