Concept explainers
In a sequence encompassing 99.4 percent of the euchromatic regions of human chromosome 1, Gregory et al. [(2006) Nature 441:315–321] identified 3141 genes.
- (a) How does one identify a gene within a raw sequence of bases in DNA?
- (b) What features of a genome are used to verify likely gene assignments?
- (c) Given that chromosome 1 contains approximately 8 percent of the human genome, and assuming that there are approximately 20,000 genes, would you consider chromosome 1 to be “gene rich”?
(a)
To determine: The ways by which an individual can identify a gene within a raw sequence of bases in DNA.
Introduction: The bioinformatics includes the use of computer hardware and software, mathematics applications to organize, share and analyze data that is related to gene structure, gene sequence and expression; and protein structure and function.
Explanation of Solution
To annotate a gene, an individual identifies gene-regulatory sequences such as promoters, enhancers, and silencers that are found upstream of genes. A person can also identify downstream elements such as termination sequences and in-frame triplet nucleotides that are part of the coding region of the gene. Moreover, 5’ and 3’ splice sites are also used. These splice sites distinguish exons from introns. The polyadenylation sites can also be used in annotation.
Thus, a person can identify a gene from the raw sequence of bases by identifying gene-regulatory sequences and the downstream elements.
(b)
To determine: The characteristics of a genome which are used to verify similar gene assignment.
Introduction: Gene is a unit of DNA that is present on a chromosome. It controls the development of one or more traits. The gene is the basic unit through which genetic information is passed from parent to offspring.
Explanation of Solution
The similarity to other annotated sequences provides an approach to a sequence’s functions, and it confirms a particular genetic assignment. Direct sequencing of cDNAs from various tissues and developmental stages aids in verification.
Thus, direct sequencing of cDNAs of a genome is used to verify similar gene assignment.
(c)
To determine: Whether the chromosome 1 will be considered as “gene rich” provided that it contains approximately 8 % of the human genome and 20,000 genes.
Introduction: The human genome is referred to as the genome of Homo sapiens. The human genome consists of 23 pairs of the chromosome with a total of about 3 billion DNA base pairs.
Explanation of Solution
The 3141 genes identified on chromosome 1which constitute 15.7 % of the total number of genes in the human genome (estimated to be 20,000). As per the given information, chromosome 1 contains 8 % of the human genome and nearly 16 % of the genes; one can say that chromosome 1 is “gene rich”.
Want to see more full solutions like this?
Chapter 21 Solutions
Concepts of Genetics (12th Edition)
- A molecular biologist is investigating homologous recombination. One aim of this study is to reconstitute stages of the process in vitro. (a) Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a stable model Holliday junction. W 5’ GATCGCATTGTAGCCGTAGGTCCACTGTAA 3’ X 5’ GTCCCATACGTAGCCGTAGGACATGTACCG 3’ Y 5’ CGGTACATGTCCTACGGCTACAATGCGATC 3’ Z 5’ TTACAGTGGACCTACGGCTACGTATGGGAC 3’ (b) What is branch migration? (c) What is the name of the enzyme that resolves a Holliday junction into two separate DNA duplexes? (d) On your diagram, indicate how the Holliday junction can be resolved in two different ways and draw the structures of the products.arrow_forwardAlthough DNA transposons are abundant in the genomes of multicellular eukaryotes, class 1 elements usually make up the largest fraction of very large genomes such as those from humans (~2500 Mb), maize (~2500 Mb), and barley (~5000 Mb). Given what you know about class 1 and class 2 elements, what is it about their distinct mechanisms of transposition that would account for this consistent difference in abundance?arrow_forwardSee the attachment and answer the following parts of the question: A) If the binturong genome is 2.87 x 109 base pairs, and the "highly repetitive DNA" fraction is composed entirely of copies of sequence 5'ATGGTCC3' and its complement, how many copies of this sequence are present in the binturong genome? B) Briefly explain, in your own words, why the fraction of the binturong DNA fragments that reannealed relatively slowly took so much longer to renature than the other DNA fragments. C) If you took more of the same randomly generated 1000 bp fragments of binturong DNA (the same sample that you used in the equilibrium density gradient centrifugation experiment described in part a and the C0t curve described in part b of this question) and used them as a sample in agarose gel electrophoresis, how many bands would you expect to find in the gel when you turned off the current and stained the gel with ethidium bromide? Briefly explain why you would predict that number of bands.arrow_forward
- In a sequence encompassing 99.4 percent of theeuchromatic regions of human chromosome 1, Gregoryet al. [(2006) Nature 441:315–321] identified 3141 genes. Q: How does one identify a gene within a raw sequence of bases in DNA?arrow_forwardSuppose that E. coli synthesizes DNA at a rate of 100,000 nucleotides per minute and takes 40 minutes to replicate its chromosome. (a) How many base pairs are present in the entire E. coli chromosome? (b) What is the physical length of the chromosome in its helical configuration—that is, what is the circumference of the chromosome if it were opened into a circle?arrow_forward(a) What two enthalpic factors stabilize DNA in double-helical form at lowtemperature?(b) What entropic factor destabilizes helical DNA at high temperature?(c) Why is the double-helical structure of DNA stabilized at moderate tohigh ionic strength?arrow_forward
- Mismatches introduced during DNA replication are detected and repaired efficiently by the “Mut” system of E. coli. (A) Please outline the steps in mismatch detection and repair by this system. (B) What is the historical reason for naming these genes “Mut” in the first place? (C) How might you identify bacterial strains with defects in the “Mut” system? (D) It has been observed that recombination-deficient mutations are usually lethal when they are combined with mutations in the mismatch repair pathway you just described. Why is that?arrow_forward100 50 104 1 10 104 Cot DNA renaturation curves occasionally show three distinct phases of renaturation. In this plot, DNA renaturation is plotted against “C,t" (initial concentration times time of renaturation, essentially a meas- ure of relative renaturation time). (a) Identify each part of this plot that corresponds to reannealing of (1) unique sequences, (2) moderately repetitive sequences, and (3) highly repetitive sequences. (b) Suppose that you cloned a single-copy gene, such as the gene for dihydrofolate reductase (DHFR), and subjected this to renaturation analysis. Sketch the curve you might expect. (c) Suppose that you cloned the DHFR CDNA instead of genomic DNA. Would you expect this to reanneal (1) more slowly, (2) more rapidly, or (3) at the same rate as genomic DNA? Briefly explain your answer. % Single strandedarrow_forwardPeople who carry a theoretical genetic disorder (called B-disease) can be identified from a 2kb DNA sequence.People who carry this genetic disorder have a single nucleotide polymorphism that results in a change of GTATCC to GGATCC, a site that only occurs once at nucleotide number 750 in this DNA sequence. Answer the following questions based on the information provided. (a) How can you develop a simple molecular test to identify the genetic disorder? (b) If you have carried out the molecular test (based on the information above) on a 100 individual and found that 24 were healthy (BB) and 26 were carriers (bb); 1) What is the ratio of heterozygous? 2) Show how can you identify the three types from the agarose gelarrow_forward
- The genome of Drosophila melanogaster, a fruit fly, was sequenced in 2000. However, this “completed” sequence did not include most heterochromatin regions. The heterochromatin was not sequenced until 2007 . Most completed genome sequences do not include heterochromatin. Why is heterochromatin usually not sequenced in genome-sequencing projects?arrow_forwardDescribe the central dogma of molecular biology.With regards to DNA, what is supercoiling and what ismeant by the terms antiparallel and complementary?arrow_forwardIn DNA-hybridization experiments on six species of plants in the genus Vicia, DNA was isolated from each of the six species, denatured by heating, and sheared into small fragments (W. Y. Chooi. 1971. Genetics 68:213–230). In one experiment, DNA from each species and from E. coli was allowed to renature. The graph shows the results of this renaturation experiment. Q. Notice that, for the Vicia species, the rate of renaturation is much faster in the first hour and then slows down. What might cause this initial rapid renaturation and the subsequent slowdown?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education