Question 5 Listen You isolate DNA from a single human cell and do PCR on an autosomal gene. How may copies will you have after 3 rounds of PCR 3 8 16 12
Q: having extra digits is a dominant trait. a man has extra digits while his wife and their daughter…
A: 1. **Genotypes of the Parents**: - The man has extra digits, so he must have at least one dominant…
Q: Calculate the pH of the resulting solution if 23.0 mL of 0.230 M HCl(aq) is added to 33.0 mL of…
A:
Q: step by step calculations please
A: 1) Step 1: 1 ng = 0.001 µg Step 2: 200 ng = 200 * 0.001 = 0.2 µg 2) Step 1: 1 µg/ml = 0.001…
Q: Anne recovers from smallpox. Is Anne likely to get sick if she is infected with the smallpox virus…
A: The question is asking whether Anne, who has recovered from smallpox, is likely to get sick again if…
Q: Are humans still evolving? Use an example from BBC's "How human culture influences our genetics."
A: Yes, humans are still evolving, and cultural practices can influence the direction and pace of human…
Q: Can you please check if these answers are correct, if not please correct them.
A: Aerobic respiration is the process where glucose is completely oxidized in the presence of oxygen.…
Q: When Galileo Galilei rolled a ball down an inclined plane, it traveled 2 meters in the first second,…
A: Approach to solving the question:Please see attached photos for detailed solutionsDetailed…
Q: Which of the following media is capable of detecting all clinically significant antibodies while…
A: The question is asking us to identify the medium that can detect all clinically significant…
Q: Mastery Dawkins, Dominic Unit 8 Test 00 4 5 of 41 < 1 2 3 4 5 6 7 8 9 10 The endosymbiotic theory of…
A: Eukaryote organelles contain DNA similar to bacterial DNAHere's why this is the strongest…
Q: having extra digits is a dominant trait. a man has extra digits while his wife and their daughter…
A: The objective of this question is to determine the probability of the couple's next child having…
Q: What deficiency disease caused by lack of starch in the diet
A: Starch is a complex carbohydrate that serves as a major source of energy in the human diet. While…
Q: Drag and drop from the available list of terms. Anabolic reactions are type of reaction. In these…
A: The building of complex molecules, such as sugars, from simpler ones is an anabolic process and is…
Q: How are genes and enzymes related?
A: The relationship between genes and enzymes is a fundamental aspect of genetics and molecular…
Q: Lab 13: Modern Human Art Worksheet Part 1. Examples of Human Art View five pieces of art, either…
A: Approach to solving the question:Detailed explanation:Examples:Key references:
Q: I need three paragraphs
A: In the thrilling adventure of survival at the secret location, I found myself surrounded by an…
Q: The signature tool of the Acheulean tool industry is the tear-drop shaped handaxe, an all purpose…
A: The question is asking whether the tear-drop shaped handaxe, which is associated with the Acheulean…
Q: Case 2: While on a summer vacation in the Gulf coast of Texas, nearly 50 guests of the Hotel…
A: 1. Disease Name and Infectious AgentThe disease afflicting the vacationers is most likely Vibrio…
Q: A ALEKS - Julianna Graham - Lex ← -> +…
A: To predict the percentage of DNA that is radioactive after each experiment, we need to understand…
Q: make a pathophysiology flow chart of Upper Respiratory Tract Infection with a data of: 3 months old…
A: The objective of the question is to create a pathophysiology flow chart for an Upper Respiratory…
Q: When discussing natural selection and behaviour, we often say that members of a species have certain…
A: Without a doubt! In order to have a better grasp of the connection between natural selection and…
Q: Total Number of Tree Snails (N) 500 300 200 8888888 700 600 400 100 0 1997 1999 2001 2003 2005 Year…
A: Based on the choices given to explain why the population of tree snails experienced a drop after the…
Q: Fraction of Age Individuals surviving RS of survivor RS of survivor carrying A, allele carrying A₂…
A: The question is asking for the interpretation of a table that represents the survival and…
Q: A child with Type O blood is born to a mother with Type B blood. What is the genotype of the child?…
A: The child has type O blood because they inherit two "O" genes, one from each parent. The mother has…
Q: 1a. What was the theme of the video "A Cup of Tea." 1b. What did you think of this video? Can you…
A: For the given prompt.
Q: Determine whether the reproductive behavior is evolutionary stable or unstable: Cowbirds are nest…
A: Here's why: Fitness Benefit for Cowbirds: Cowbirds benefit from this behavior by avoiding the costs…
Q: Case 4: A man in his early 20's has come to the emergency room complaining of painful urination…
A: Note: Hello, student. I sincerely hope I was able to answer your question. If you have any more…
Q: There is only one correct way to perform antibody identification Question 4 options:…
A: The objective of the question is to determine whether there is only one correct method to perform…
Q: Can you please give a basic information on Sertraline?
A: Sertraline is a type of medication known as a selective serotonin reuptake inhibitor (SSRI). It's…
Q: Im not sure what I have written is right so far
A: The objective of this question is to predict the phenotypic ratios of the F1 and F2 generations in a…
Q: crocs and relatives homed dome- heads duckbills souropods prosauropods other theropods…
A: Certainly! In evolutionary biology, when we talk about groups of organisms in relation to their…
Q: Find an occurence where a biomechanical therory or concept was being used in a tv show/advertisement…
A: a) One example of a biomechanical theory being used in a TV show is in an episode of "MythBusters."…
Q: What are the functions of the repeats, the spacers and the Cas9 enzyme?
A: The question is asking about the functions of three key components of the CRISPR-Cas9 system, which…
Q: Mr. Conti died from a smallpox infection. The graphs (pictured) illustrate Anne's immune response…
A: Approach to solving the question:Anne's Response to Immunity (Survived):a rise in antibodies that…
Q: Based on the available evidence, which is NOT true about the australopiths: A) had small,…
A: Approach to solving the question:To approach the question systematically and accurately, follow…
Q: Juvenile Diabetes (Type I) is an autoimmune disease. What does this mean and how does this lead to…
A: Juvenile Diabetes (Type I) is a condition where the body's immune system mistakenly targets and…
Q: Find an occurence where a biomechanical therory or concept was being used in a tv show/advertisement…
A: Biomechanics in Action: Exploring "The Six Million Dollar Man"The 1960s television series "The Six…
Q: 2. What is the best way to approach toileting with persons with Alzheimer’s disease? Upon request…
A: Proactive:Observe their routine: Look for signs they might need to use the restroom, like…
Q: Evaluating the positive and negative effects stress has on the human body 1. Does stress affect our…
A: Approach to solving the question: In exploring the question of whether stress affects our ability to…
Q: how is the heridetary material organised in the nucleus and the chromosomes
A: The hereditary material in a cell is organized in the nucleus, which is a membrane-bound organelle…
Q: What are the characteristics/prominate features of a Early modern Homo sapiens skull?
A: The objective of this question is to identify and describe the key characteristics or features of an…
Q: Genetics Q3
A: The question is asking about the component of the CRISPR-Cas9 system that connects the Cas9 enzyme…
Q: Please draw it out so I understand how it's suppose to be drawn
A: I hope this was helpful If any doubts please ask for clarificationPlease give helpful rating if you…
Q: 2. Below is an example of an image of genomic DNA extracted from whole blood analysed by agarose gel…
A: Answer well explained above.
Q: Which statement is NOT true about the early hominins: A) The angle of the foramen magnum on…
A: The objective of the question is to identify the statement that is not true about the early…
Q: make sure it’s correct i need asap
A: in a given region, there are more producer species than herbivore and carnivore species due to…
Q: The reason the elasticity and surface tension of the lungs do not cause the lungs to collapse…
A: Elasticity and Surface Tension: Lungs have elasticity, meaning they have a tendency to recoil or…
Q: Why do birds fly?
A: 1. "Foraging": Birds have developed the ability to hunt from above, which enables them to harvest…
Q: Black men are more likely to get prostate cancer than other men. You are working on a prostate…
A: The objective of the question is to understand the various procedures involved in a prostate cancer…
Q: What are the subsectors of the fisheries and aquaculture sector? Select two or more:…
A: The question is asking to identify the subsectors of the fisheries and aquaculture sector. The…
Q: For which disease active and passive immunization (antibodies) is given simultaneously? Explain how…
A: Approach to solving the question: Detailed explanation: Examples: Key references: Health Science
GQ5
Unlock instant AI solutions
Tap the button
to generate a solution
Click the button to generate
a solution
- Quèstion 34 Enzyme that joins the DNA fragments O Recombinant DNA Technology O Restriction enzymes O Ligase O Palindromic sequencesQUESTION 17 OL NEere interested in generating a PCR amplicon including the bracketed sequence below. Which of the following sequences would be canen hybridizing (annealing) with the target AND would also serve to generate a copy of the bracketed region of interest? 5'-AATCGT[AGCAGCAGCAGTGGCT]A AGCT-3 3' -TTAGCA[TC GTC GTC GTC ACC G A] TTCG A - 5' 3-TTAGC-S S-AATCG-3 OSAAGCT-3 5-AGCTT-3 5-GCTAA-3 5-TCGAA-3 QUESTION 18 Vhich of the following is/are true regarding the enzvme PRIMASE? Save and Submit to save and submit. Click Save All Answers to save all answers.QUESTION 19 Match the major enzyme involved in the techniques/steps we discussed in class v PCR A. Reverse Transcriptase v CDNA synthesis B. any enzyme that can cleave a chromogenic substrate v Cutting a plasmid for cloning C. Cas9 v "Gluing" an insert into a plasmid D. DNA polymerase v ELISA E. Restriction enzymes v Knocking out a gene at a specific targeted sequence F. Ligase
- Question 5 Review Figure 21.6 types of DNA sequences in the human genome. The lowest percentage of human genome O repetitive DNA related to transposable elements and related sequences (L1 sequences and Alu elements) O repetitive DNA unrelated to transposable elements (simple sequence and large-segment duplications O unique noncoding DNA O introns O exons O regulatory sequencesQUESTION 23 Michelle has a clone of the DNA of a newly discovered virus. She wants to identify which specific cells of an organ are infected by the virus. What method would be the most useful to answer this question? O restriction fragment analysis O microinjection of the gene fragment O Sanger sequencing of the clone O FISH (fluorescent in situ hybridization) O real time PCR QUESTION 24 Mutagens are useful in biotechnology research for Click Save and Submit to save and submit. Click Save All Answers to save all answers. Save All AnsweQUESTION 7 After you graduate, you are working at a laboratory that identifies a novel protein called Leprechaun. To determine in which organelles Leprechaun is found, you decide to express the Leprechaun gene in HeLa cells using a plasmid. Since you have generated an antibody that recognizes an epitope within the Leprechaun protein, which technique will you use to identify its localization within the HeLa cells? OA. SDS-PAGE O B. Immunocytochemistry O C. Western blot OD. Transmission electron microscopy (TEM) OE. Immunohistochemistry QUESTION 8 Which of the following statements regarding electron microscopy is TRUE? OA. White light is utilized to illuminate the sample for imaging in all types of electron microscopy. OB. Electrons pass through the object being examined in transmission electron microscopy (TEM). OC. In scanning electron microscopy (SEM) electrons, electrons bounce off the surface of the sample. OD. Electron microscopy can be used to view structures as small as 2 nm in…
- Question 5 Review DNA sequencing and cloning tools. Which of these is not used to make a recombinant DNA? O restriction enzymes to create sticky ends of a plasmid O fragment from a different DNA cut by the same restriction enzyme O DNA ligase seals the recombinant DNA O denaturationQUESTION 3 You are provided with plasmid DNA at 200ng/uL, 10X restriction digestion buffer, restriction enzymes (1 unit/ul) and water. You want to digest 1.5 ug of plasmid DNA with 1 unit (U) of enzyme in 1X buffer in a total volume of 80 ul. Complete the table below: Solution Stock solution Working solution Volume needed restriction digestion buffer 10X 1X DNA 200 ng/ul 1.5 με enzymes 1 unit/ul 1 unit Water Total 80 μLQuestion 3. Biochemistry techniques have been used for the analysis on biomolecules such as enzymes, DNA, antibodies and other molecules in biomedical engineering. a) Polymerase chain reaction (PCR) is an artificial method to amplify DNA segment into thousand copies of that DNA. i. Elaborate the three steps in PCR which based on temperature manipulation in controlling the replication process. Distinguish the uniqeness of Reverse Transcriptase PCR (RT-PCR) technique as ii. compared to the common PCR. iii. Relate the application of RT-PCR and Rapid Diagnostic Test for biomarker detection with the typical time course of COVID-19 infection.
- Question 35 Enzymes used in Recombinant DNA Technology O Recombinant DNA Technology O Restriction enzymes O Restriction Enzymes and Ligase O Palindromic sequencesQuestion 13 The reason Toq polymerase is specifically desirable for use in PCR is that it does not (itself) denature at the high temperatures necessary to denature DNA. O True O FalseQUESTION 1 The sequence of a DNA including the gene that you want to clone into a plasmid vector. The gene of interest is in bold with the stop codon shown in green. The sequence has no suitable restriction site for digestion to isolate the gene fragment for cloning. Recognition site of Sal-I enzyme is given below. Design a primer to introduce the Sal-I site to the beginning of the gene. Write the complementary DNA sequence Design the primer and show which strand of DNA it is complementary to Mark the direction of all DNA sequences including the primer. 5-TGTCAGCACCATCTGTCCGGTCCCAGCATGCCTTCTGAGACCCAGGCAG(1500b)TGGGGCTGACTCTTTA-3 Sal-1 recognition site GTCGAC CAGCTG THIS IS COMPLETE QUESTION. PLEASE EXPLAIN EACH PART OF GTHE QUESTION.