Genetic Analysis: An Integrated Approach (3rd Edition)
3rd Edition
ISBN: 9780134605173
Author: Mark F. Sanders, John L. Bowman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 1, Problem 29P
Consider the following segment of DNA:
5’-…ATGCCAGTCACTCACTTG…-3’
3’-…TACGGTCAGTGAGTGAAC…-5’
How many phosphodiester bonds are required to form this segment of double-stranded DNA?
How many hydrogen bonds are present in this DNA segment?
If the lower strand of DNA serves as the template transcribed into mRNA, how many peptide bonds are present in the polypeptide fragment into which the mRNA is translated?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
The DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’ and Non-template strand = 5' - ATG-TCG-TGA-GTC-AGT - 3' .
If on the non-coding strand of DNA there is suddenly one T base that sneaks into the 4th sequence (from the left), or causes a mutation, then how will the RNA be formed and the chain arrangement of the amino acids produced by this mutation?
4th sequence (from the left) should be = TCG right?
The DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’, and Non-template strand = 5' - ATGTCGTGAGTCAGT - 3' .
If on the non-coding strand of DNA there is suddenly one T base that sneaks into the 4th sequence (from the left), or causes a mutation, then how will the RNA be formed and the chain arrangement of the amino acids produced by this mutation?
For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’
Write:
a) the sequence of the complementary DNA strand
Chapter 1 Solutions
Genetic Analysis: An Integrated Approach (3rd Edition)
Ch. 1 - 1. Genetics affects many aspects of our lives....Ch. 1 - 2. How do you think the determination that DNA is...Ch. 1 - 3. A commentator once described genetics as “the...Ch. 1 - All life shares DNA as the hereditary material....Ch. 1 - Define the terms allele, chromosome, and gene and...Ch. 1 - 6. Define the terms genotype and phenotype, and...Ch. 1 - 7. Define natural selection, and describe how...Ch. 1 - Describe the modern synthesis of evolution, and...Ch. 1 - What are the four processes of evolution? Briefly...Ch. 1 - Define each of the following terms: a....
Ch. 1 - 11. Compare and contrast the genome, the proteome,...Ch. 1 - With respect to transcription describe the...Ch. 1 - Plant agriculture and animal domestication...Ch. 1 - Briefly describe the contribution each of the...Ch. 1 - If thymine makes up 21% of the DNA nucleotides in...Ch. 1 - What reactive chemical groups are found at the 5...Ch. 1 - Identify two differences in chemical composition...Ch. 1 - What is the central dogma of molecular biology?...Ch. 1 - A portion of a polypeptide contains the amino...Ch. 1 - The following segment of DNA is the template...Ch. 1 - 23. Fill in the missing nucleotides (so there are...Ch. 1 - 24. Suppose a genotype for a protein-producing...Ch. 1 - Prob. 25PCh. 1 - 26. Four nucleic acid samples are analyzed to...Ch. 1 - 27. What is meant by the term homology? How is...Ch. 1 - 28. If one is constructing a phylogeny of reptiles...Ch. 1 - 29. Consider the following segment of...Ch. 1 - 30. Ethical and social issues have become a large...Ch. 1 - 31. In certain cases, genetic testing can identify...Ch. 1 - 32. What information presented in this chapter and...Ch. 1 - 33. It is common to study the biology and genetics...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Using Figures 8.7 and 8.9 as a guide, draw a dinucleotide composed of C and A. Next to this, draw the complementary dinucleotide in an antiparallel fashion. Connect the dinucleotides with the appropriate hydrogen bonds. FIGURE 8.9 The two polynucleotide chains in DNA run in opposite directions. The left strand runs 5 to 3, and the right strand runs 3 to 5. The base sequences in each strand are complementary. An A in one strand pairs with a T in the other strand, and a C in one strand is paired with a G in the opposite strand. FIGURE 8.7 Nucleotides can be joined together to form chains caled polynucleotides. Polynucleotides are polar molecules with a 5 end (at the phosphate group) and a 3 end (at the sugar group). An RNA polynucleotide is shown at the left, and a DNA polynucleotide is shown at the right.arrow_forwarddetermine what amino acid will be formed from the given DNA strand below: 3’ T A C A T G C C G A A T G C C 5’ Note: Prepare the partner strand of this DNA. Discuss how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used. Look at the genetic code to know what amino acid will become part of the polypeptide chain. 1. Partner DNA strand 2. the mRNA strand 3. the tRNA 4. the formed amino acids 5. the discussion of the entire procedurearrow_forwardHere is a DNA coding strand’s sequence and direction: 5’-ATGCCGATATAG-3’ . What would be the amino acid sequence in the polypeptide encoded by this DNA?arrow_forward
- The template strand of a double helical segment of DNA consists of the following sequence: 5’-GTAGCCTTAAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACTCTCATGTATAGTTG-3’ What is the nucleotide order in the complementary DNA strand?arrow_forwardGive the complimentary DNA strand for the following:ACG TAG CTA GTC AGT CGT AGC Give the RNA strand for the following:ACG TAG CTA GTC AGT CGT AGC Using the provided amino acid table and the RNA strand you created in #2, create the amino acid sequence: Name and explain two different ways in which DNA can be damaged. Once DNA is damaged, can we repair it? If not, what are some possible outcomes from the damaged DNA?arrow_forwardThe sequence of the DNA template strand is 3’–ATGGCAATAC–5’: What is the sequence of the DNA informational strand? What are the amino acids present in this sequence?arrow_forward
- Give the base sequence of the complementary DNA strand of the DNA chain with the following base sequence: 5’ ACGTAG 3’arrow_forwardWhich of the following pieces of DNA is going to be easier to separate into single stranded molecules using heat (ie, have a lower melting point), which breaks hydrogen bonds? Why? 1. 5’ ATTTTCCGTAAT 3’ 3’ TAAAAGGCATTA 5’ 2. 5’ ACGGTTTACCGG 3’ 3’ TGCCAAATGGCC 5’ A) 2; it has more C-G pairs which are connected by three hydrogen bonds instead of two, so they are easier to break. B) 1; it has more A-T pairs which are connected by one hydrogen bond instead of two, so they are easier to break. C) 2; it has more C-G pairs which are connected by two hydrogen bonds instead of three, so they are easier to break. D)1; it has more A-T pairs which are connected by two hydrogen bonds instead of three, so they are easier to break.arrow_forwardGiven the active site diagram below, please identify the residue participating in a charge-charge interation. HO OH HN OH 5 ΝΗ *HN ΝΗ OH O Zn²+ 2 4 5 3 1 2 NH 3arrow_forward
- Give the sequence of the complementary DNA strand for the DNA chain with the following base sequence5'-TATGGCATAC-3'arrow_forwardAs you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________arrow_forwardGiven the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide using the 3’ – 5’ strand as the template. use drawings and diagrams to describe how the DNA strand will be synthesized into a functional protein.5’ - TATAAAAASSMSBMDATGSBDCCMBDBAATBSMDSTGTGTCCTMSBAG – 3’(KEY: The letters SBMD are “made up” nucleic acids that depict non-coding regions in the DNA, hypothetically S pairs with B and M pairs with D)arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY