Life: The Science of Biology
Life: The Science of Biology
11th Edition
ISBN: 9781319010164
Author: David E. Sadava, David M. Hillis, H. Craig Heller, Sally D. Hacker
Publisher: W. H. Freeman
bartleby

Concept explainers

bartleby

Videos

Question
Book Icon
Chapter 14.3, Problem 1R
Summary Introduction

To review:

The reason of having nucleotide triplets in the genetic code like AUG, and not singlets or doublets.

Introduction:

The genetic code is a guide that defines how the information in the form of nucleotides on the deoxyribonucleic acid (DNA) is converted to amino acids. The nucleotides that form the backbone of DNA along with sugar and phosphate moieties are adenine (A), guanine (G), cytosine (C), and thymine (T). On the ribonucleic acid (RNA) strand, there is uracil (U) instead of thymine. Three nucleotides form one codon, which translates into an amino acid.

Blurred answer
Students have asked these similar questions
What is the meaning of the statement “The code is redundant but not ambiguous?”.
The genetic code consists of a series of three-base wordsthat each code for a given amino acid.(a) Using the selections from the genetic code shown below, de-termine the amino acid sequence coded by the following seg-ment of RNA: UCCACAGCCUAUAUGGCAAACUUGAAG AUG= methionine ;CCU= proline; CAU= histidine ;UGG= tryptophan AAG= lysine ; UAU= tyrosine ;GCC= alanine ;UUG= leucine ;CGG= arginine ;UGU= cysteine ;AAC =asparagine ;ACA=threonine ;UCC= serine ;GCA=alanine ;UCA=serine(b) What is the complementary DNA sequence from which this RNA sequence was made? (c) If you were sequencing the DNA fragment in part (b), how many complementary chain pieces would you obtain in the tube containing ddATP?
Use the following DNA sequence, and write the resulting messenger RNA sequence TACTTTGAATGCGGCCGTATC?
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Text book image
BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)
Biology
ISBN:9781305967359
Author:STARR
Publisher:CENGAGE L
Text book image
Principles Of Radiographic Imaging: An Art And A ...
Health & Nutrition
ISBN:9781337711067
Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
Publisher:Cengage Learning
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license