Biology: The Dynamic Science (MindTap Course List)
4th Edition
ISBN: 9781305389892
Author: Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Textbook Question
Chapter 18, Problem 1ITD
You learned in the chapter that an STR locus is a locus where alleles differ in the number of copies of a short, tandemly repeated DNA sequence. PCR is used to determine the number of alleles present, as shown by the size of the DNA fragment amplified. In the Figure below are the results of PCR analysis for STR alleles at a locus where the repeat unit length is 9 bp, and alleles are known that have 5 to 11 copies of the repeat. Given the STR alleles present in the adults, state whether each of the four juveniles could or could not be an off-spring of those two adults. Explain your answers.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
The temperature at which the primers and target DNA hybridize may be changed to influence the stringency of PCR amplification. What effect will changing the hybridization temperature have on the amplification? Let's say you have a certain yeast gene A and want to check whether it has a human equivalent. How might managing the hybridization's rigor benefit you?
For the STR site diagramed below, each repeat unit, represented by a rectangle, is known to be 5 bp long. The total length of
the amplified PCR product for the chromosome shown below is 420 bp long.
PCR product - 420 bo
Primer
Left
STR STR STR STR
Primer
Right
What size would the PCR product be for a different chromosome where there were only two tandem repeat units, instead of
four? SHOW YOUR WORK.
To generate large amounts of DNA to manufacture gene therapy payloads or to be
able to see them on gel electrophoresis, specific sequences can be amplified by PCR.
For a sequence of a 100 base pairs, calculate the number cycles of PCR required to
generate 1 ng of DNA, when starting from a single copy.
Note that the molar mass of an average DNA bp is 600 g/mol.
Chapter 18 Solutions
Biology: The Dynamic Science (MindTap Course List)
Ch. 18.1 - What features do restriction enzymes have in...Ch. 18.1 - Prob. 2SBCh. 18.1 - What information and materials are needed to...Ch. 18.2 - What is a transgenic organism?Ch. 18.2 - Prob. 2SBCh. 18.3 - What is a restriction fragment length polymorphism...Ch. 18.3 - Prob. 2SBCh. 18.3 - Prob. 3SBCh. 18 - Prob. 1TYKCh. 18 - Prob. 2TYK
Ch. 18 - Why are antibiotic resistance markers such as ampR...Ch. 18 - After a polymerase chain reaction (PCR), agarose...Ch. 18 - A cDNA and a cloned fragment of genomic DNA share...Ch. 18 - Prob. 6TYKCh. 18 - Which of the following is not true of somatic cell...Ch. 18 - Prob. 8TYKCh. 18 - Prob. 9TYKCh. 18 - Prob. 10TYKCh. 18 - Prob. 11TYKCh. 18 - Discuss Concepts A forensic scientist obtained a...Ch. 18 - 13. Suppose a biotechnology company has developed...Ch. 18 - Prob. 14TYKCh. 18 - You learned in the chapter that an STR locus is a...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Select all that would be true if I had a nonsense mutation in an exon of a gene: The nonsense mutant allele would be the same size as wildtype by PCR-electrophoresis The nonsense mutant protein would be the same size by Western as the wildtype protein The nonsense mutant allele would be a different size compared to wildtype by PCR- electrophoresis The nonsense mutant protein would be a different size by Western compared to the wildtype proteinarrow_forwardDescribe the possible outcome of a PCR experiment in which (a) there is a single-stranded break in the target DNA sequence, which is present in only one copy in the starting sample, and (b) there is a doublestranded break in the target DNA sequence, which is present in only one copy in the starting sample.arrow_forwardThe exponential nature of PCR allows spectacular increases in the abundanceof a DNA sequence being amplified. Consider a 10-kbp DNA sequence in agenome of 1010 base pairs. What fraction of the genome does this sequence represent? That is, what is the fractional abundance of this sequence in this genome?Calculate the fractional abundance of this target sequence after 10, 15, and 20 cycles of PCR, starting with DNA representing the whole genome and assuming that no other sequences in the genome undergo amplification in the process.arrow_forward
- Here is a DNA agarose gel showing PCR products from a mouse genotyping experiment. Genotyping tells us whether each mouse is a wild type mouse (i.e. not genetically modified) or a mutant mouse. Interpret the results for each mouse 1-3.arrow_forwardYou are using the restriction enzyme HAEIII to digest different samples of the taster gene isolated from cheek cells of different people and amplified by PCR. When viewing the bands on the electrophoresis gel, one would expect that a taster (homozygote) would have---------band(s), whereas a carrier (heterozygote) would show--------band(s), and a non-taster would show------band(s).arrow_forwardYou have two tubes, each with a pair of DNA fragments inside them. Tube #1 has fragments that are 500bp and 1000 bp in length. Tube #2 has fragments that are 7500bp and 8000bp in size. If you were to perform agarose gel electrophoresis and run the contents of each tube in two separate lanes on the same gel, what would you expect to see? O That the difference between the distances migrated by the two fragments in Tube #1 was much greater than the difference between the distances migrated by the two fragments in Tube #2. O That the difference between the distances migrated by the two fragments in Tube #1 was the same as difference between the distances migrated by the two fragments in Tube #2. O That the difference between the distances migrated by the two fragments in Tube #1 was much less than the difference between the distances migrated by the two fragments in Tube #2. O It is not possible to estimate what we would expect to see.arrow_forward
- The answer is option A In the PCR amplification, two primers are used to flank the target region to amplification. The two primers are forward primer and reverse primer. The forward primer binds to the template DNA and the reverse primer binds to the complementary strand. Step 2 In the above question, the two sequences of 21bp primers in the 5' to 3' Orientation that allows amplifying the given gene sequence are : ATGTTTGTTTTTCTTGTTTTA and GTCAAATTACATTACACATAA CAN YOU FURTHER EXPLAIN WHY IT IS "GTCAAATTACATTACACATAA," I don't understand why it's called reverse primer? and where exactly it is binding to on the strand? (A picture would really help)arrow_forwardThe exponential nature of PCR allows spectacular increases in the abundance of a DNA sequence being amplified. Consider a 10-kbp DNA sequence in a genome of 1010 base pairs. What fraction of the genome is represented by this sequence; i.e., what is the fractional abundance of this sequence in this genome? Calculate the fractional abundance of this target sequence after 10, 15, and 20 cycles of PCR, starting with DNA representing the whole genome and assuming that no other sequences in the genome undergo amplification in the process.arrow_forwardYou want to clone a specific PCR amplicon. You have determined that the amplicon you want to clone has enzyme restriction sites for HindIII and EcoRI. After investigation you have seen that the pUC18/19 plasmid also have these enzyme restriction sites in its multiple cloning site (MCS on map included). After enzyme digestion your amplicon is 854 bp long. What length will the recombinant plasmid be after you have inserted your amplicon? Show a calculation.arrow_forward
- What is expected theoretical number of copies of DNA molecules after 28 cycles in a PCR experiment? What is the percent efficiency of the PCR experiment if the actual number of copies was 500,000,000? Show your calculationsarrow_forwardYour graduate advisor asks you to amplify the following sequence of DNA by PCR: 5’-ATACGCATTCGGACCAGGTCCTAA-3’ 3’-TATGCGTAAGCCTGGTCCAGGATT-5’ a. To ensure that the entire sequence above is amplified, what 6-nucleotide DNA primers should you add to your PCR mix? You order the primers listed above, but instead receive the following set of primers: 5’-CGCATT-3’ 5’-GGACCT-3’ b. What portion of the double stranded DNA molecule will be amplified after 10 rounds of PCR? Your labmate attempts to rescue your PCR reaction by providing you with the following set of primers: 5’-ATACGC-3’ 5’-TCCTAA-3’ c. What is the result of running the PCR reaction with your labmate’s primers? How many double stranded molecules of DNA will result from 10 rounds of amplification?arrow_forwardHow is the color of the spot coverted into useful data if data is collected from a Vicrochip DNA microarray that's from the colors of spots that illuminate when the spots have a laser shine on them? From the following which one is the best option The color of the spot is converted to a number that represents the intensity of green or red, so that the numerical intensity values can be compared between spots by a computer program The color of the spot is bright so that it can be interpreted visually by trained scientists The color of the spot is present on the chip, counted and a ratio of red-yellow and green-yellow is calculated which can be done by hand The color of the spot can't be converted None of the abovearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
DNA Use In Forensic Science; Author: DeBacco University;https://www.youtube.com/watch?v=2YIG3lUP-74;License: Standard YouTube License, CC-BY
Analysing forensic evidence | The Laboratory; Author: Wellcome Collection;https://www.youtube.com/watch?v=68Y-OamcTJ8;License: Standard YouTube License, CC-BY