Fundamentals of General, Organic, and Biological Chemistry (8th Edition)
Fundamentals of General, Organic, and Biological Chemistry (8th Edition)
8th Edition
ISBN: 9780134015187
Author: John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson
Publisher: PEARSON
bartleby

Concept explainers

bartleby

Videos

Question
Book Icon
Chapter 26.4, Problem 26.8P

(a)

Interpretation Introduction

Interpretation:

The complementary sequence of bases for each given DNA strand has to be written.

Concept Introduction:

Composition of nucleic acid: Nucleic acid is a polymer of nucleotides. Each nucleotide has three parts: a sugar, a nitrogenous base, and a phosphate group. Two nucleotides are joined by phosphate diester linkage where a free phosphate on 5’ carbon of one nucleotide and a free –OH group on 3’ carbon of another nucleotide.

Base pairing in DNA: The two strands of the DNA double helix run in the opposite directions- one in 5’ to 3’ direction and other from 3’ to 5’ direction. The hydrogen bonding between two strands enhances the stability of the DNA; where the alignment of hydrophobic nitrogenous bases in the interior and hydrophilic phosphate and sugar groups on the exterior also enhance the stability. Adenine and thymine gives a pair forming two hydrogen bonds and cytosine and guanine gives rise to another pair forming three hydrogen bonds.

Sugar: In both DNA and RNA, sugar portion is found. In DNA, the sugar is D-ribose, where at 2’hydroxyl group is absent and in RNA, the hydroxyl group is present at 2’.

Nitrogenous bases: Five types of nitrogenous bases (has unique one-letter code A, G, T, U, and C) are derived from two parent compounds called purine and pyrimidine. The purine derivatives are Adenine and Guanine are two fused nitrogen containing rings. The pyrimidine derivatives are Thymine, Cytosine, and Uracil are only one nitrogen containing six-membered ring.  Adenine, Guanine, Thymine, and Cytosine are the nitrogenous bases present in DNA. Adenine, Guanine, Cytosine and Uracil are the nitrogenous bases present in RNA.

(b)

Interpretation Introduction

Interpretation:

The complementary sequence of bases for each given DNA strand has to be written.

Concept Introduction:

Composition of nucleic acid: Nucleic acid is a polymer of nucleotides. Each nucleotide has three parts: a sugar, a nitrogenous base, and a phosphate group. Two nucleotides are joined by phosphate diester linkage where a free phosphate on 5’ carbon of one nucleotide and a free –OH group on 3’ carbon of another nucleotide.

Base pairing in DNA: The two strands of the DNA double helix run in the opposite directions- one in 5’ to 3’ direction and other from 3’ to 5’ direction. The hydrogen bonding between two strands enhances the stability of the DNA; where the alignment of hydrophobic nitrogenous bases in the interior and hydrophilic phosphate and sugar groups on the exterior also enhance the stability. Adenine and thymine gives a pair forming two hydrogen bonds and cytosine and guanine gives rise to another pair forming three hydrogen bonds.

Sugar: In both DNA and RNA, sugar portion is found. In DNA, the sugar is D-ribose, where at 2’hydroxyl group is absent and in RNA, the hydroxyl group is present at 2’.

Nitrogenous bases: Five types of nitrogenous bases (has unique one-letter code A, G, T, U, and C) are derived from two parent compounds called purine and pyrimidine. The purine derivatives are Adenine and Guanine are two fused nitrogen containing rings. The pyrimidine derivatives are Thymine, Cytosine, and Uracil are only one nitrogen containing six-membered ring.  Adenine, Guanine, Thymine, and Cytosine are the nitrogenous bases present in DNA. Adenine, Guanine, Cytosine and Uracil are the nitrogenous bases present in RNA.

Blurred answer
Students have asked these similar questions
Write the sequence of the complementary DNA strand that pairs with each of the following DNA base sequences:(a) TTAGCC(b) AGACAT
For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the complementary DNA strand
Write the sequence of the complementary DNA strand thatpairs with each of the following DNA base sequences:(a) GGTTAC(b) CCCGAA

Chapter 26 Solutions

Fundamentals of General, Organic, and Biological Chemistry (8th Edition)

Ch. 26.4 - Prob. 26.11KCPCh. 26.6 - What are Okazaki fragments? What role do they...Ch. 26.6 - Prob. 26.13PCh. 26.8 - Prob. 26.14PCh. 26.8 - Prob. 26.15PCh. 26.9 - Prob. 26.1CIAPCh. 26.9 - Prob. 26.2CIAPCh. 26.9 - Using a variety of sources, research which...Ch. 26.9 - Prob. 26.4CIAPCh. 26.9 - List possible codon sequences for the following...Ch. 26.9 - Prob. 26.17PCh. 26.9 - What amino acids do the following sequences code...Ch. 26.9 - Prob. 26.19PCh. 26.10 - Prob. 26.20PCh. 26.10 - What anticodon sequences of tRNAs match the mRNA...Ch. 26 - Combine the following structures to create a...Ch. 26 - Prob. 26.23UKCCh. 26 - Copy the following simplified drawing of a DNA...Ch. 26 - Prob. 26.25UKCCh. 26 - Prob. 26.26UKCCh. 26 - Prob. 26.27APCh. 26 - Prob. 26.28APCh. 26 - Prob. 26.29APCh. 26 - Prob. 26.30APCh. 26 - Prob. 26.31APCh. 26 - For the following molecule: (a) Label the three...Ch. 26 - Prob. 26.33APCh. 26 - Prob. 26.34APCh. 26 - Prob. 26.35APCh. 26 - Prob. 26.36APCh. 26 - Draw structures to show how the sugar and...Ch. 26 - What is the difference between the 3 end and the 5...Ch. 26 - Prob. 26.39APCh. 26 - Prob. 26.40APCh. 26 - Draw the complete structure of the RNA...Ch. 26 - Prob. 26.42APCh. 26 - Prob. 26.43APCh. 26 - Prob. 26.44APCh. 26 - Prob. 26.45APCh. 26 - If a double-stranded DNA molecule is 22% G, what...Ch. 26 - How are replication, transcription, and...Ch. 26 - Why is more than one replication fork needed when...Ch. 26 - Prob. 26.49APCh. 26 - What are the three main kinds of RNA, and what are...Ch. 26 - Prob. 26.51APCh. 26 - Prob. 26.52APCh. 26 - Prob. 26.53APCh. 26 - Prob. 26.54APCh. 26 - What is a codon and on what kind of nucleic acid...Ch. 26 - Prob. 26.56APCh. 26 - Prob. 26.57APCh. 26 - Prob. 26.58APCh. 26 - What amino acids are specified by the following...Ch. 26 - Prob. 26.60APCh. 26 - What anticodon sequences are complementary to the...Ch. 26 - Prob. 26.62APCh. 26 - Refer to Problem 26.62. What sequence appears on...Ch. 26 - Refer to Problems 26.62 and 26.63. What dipeptide...Ch. 26 - Prob. 26.65APCh. 26 - Prob. 26.66APCh. 26 - Prob. 26.67APCh. 26 - Prob. 26.68APCh. 26 - Prob. 26.69APCh. 26 - Prob. 26.70CPCh. 26 - Prob. 26.71CPCh. 26 - Prob. 26.73CPCh. 26 - Prob. 26.75GPCh. 26 - Prob. 26.76GPCh. 26 - Prob. 26.77GPCh. 26 - Prob. 26.78GP
Knowledge Booster
Background pattern image
Biochemistry
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Text book image
BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)
Biology
ISBN:9781305967359
Author:STARR
Publisher:CENGAGE L
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license